ID: 1062855618

View in Genome Browser
Species Human (GRCh38)
Location 10:778182-778204
Sequence TGCCCCCACCAAGCAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062855606_1062855618 30 Left 1062855606 10:778129-778151 CCAACCAAACATCCCATCCGCAG No data
Right 1062855618 10:778182-778204 TGCCCCCACCAAGCAGGAGCAGG No data
1062855612_1062855618 17 Left 1062855612 10:778142-778164 CCATCCGCAGTGGGGCTCCTTAG No data
Right 1062855618 10:778182-778204 TGCCCCCACCAAGCAGGAGCAGG No data
1062855614_1062855618 0 Left 1062855614 10:778159-778181 CCTTAGCAGTAGAAAACCACTCC No data
Right 1062855618 10:778182-778204 TGCCCCCACCAAGCAGGAGCAGG No data
1062855611_1062855618 18 Left 1062855611 10:778141-778163 CCCATCCGCAGTGGGGCTCCTTA No data
Right 1062855618 10:778182-778204 TGCCCCCACCAAGCAGGAGCAGG No data
1062855613_1062855618 13 Left 1062855613 10:778146-778168 CCGCAGTGGGGCTCCTTAGCAGT No data
Right 1062855618 10:778182-778204 TGCCCCCACCAAGCAGGAGCAGG No data
1062855608_1062855618 26 Left 1062855608 10:778133-778155 CCAAACATCCCATCCGCAGTGGG No data
Right 1062855618 10:778182-778204 TGCCCCCACCAAGCAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062855618 Original CRISPR TGCCCCCACCAAGCAGGAGC AGG Intergenic