ID: 1062856293

View in Genome Browser
Species Human (GRCh38)
Location 10:781075-781097
Sequence CGTGGTCACCTGCATCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062856293_1062856303 20 Left 1062856293 10:781075-781097 CCACCAGGATGCAGGTGACCACG No data
Right 1062856303 10:781118-781140 GTCTCAGCGGGAGGCAGCACGGG No data
1062856293_1062856299 7 Left 1062856293 10:781075-781097 CCACCAGGATGCAGGTGACCACG No data
Right 1062856299 10:781105-781127 TGGAGATGATGTAGTCTCAGCGG No data
1062856293_1062856300 8 Left 1062856293 10:781075-781097 CCACCAGGATGCAGGTGACCACG No data
Right 1062856300 10:781106-781128 GGAGATGATGTAGTCTCAGCGGG No data
1062856293_1062856305 26 Left 1062856293 10:781075-781097 CCACCAGGATGCAGGTGACCACG No data
Right 1062856305 10:781124-781146 GCGGGAGGCAGCACGGGCCTGGG No data
1062856293_1062856302 19 Left 1062856293 10:781075-781097 CCACCAGGATGCAGGTGACCACG No data
Right 1062856302 10:781117-781139 AGTCTCAGCGGGAGGCAGCACGG No data
1062856293_1062856301 11 Left 1062856293 10:781075-781097 CCACCAGGATGCAGGTGACCACG No data
Right 1062856301 10:781109-781131 GATGATGTAGTCTCAGCGGGAGG No data
1062856293_1062856304 25 Left 1062856293 10:781075-781097 CCACCAGGATGCAGGTGACCACG No data
Right 1062856304 10:781123-781145 AGCGGGAGGCAGCACGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062856293 Original CRISPR CGTGGTCACCTGCATCCTGG TGG (reversed) Intergenic