ID: 1062856656

View in Genome Browser
Species Human (GRCh38)
Location 10:783263-783285
Sequence AGGAATCCTGTATTTCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062856656_1062856665 26 Left 1062856656 10:783263-783285 CCACCAGGAAATACAGGATTCCT No data
Right 1062856665 10:783312-783334 TTGAACCAGAGCGCGGCCCTGGG No data
1062856656_1062856664 25 Left 1062856656 10:783263-783285 CCACCAGGAAATACAGGATTCCT No data
Right 1062856664 10:783311-783333 CTTGAACCAGAGCGCGGCCCTGG No data
1062856656_1062856659 -2 Left 1062856656 10:783263-783285 CCACCAGGAAATACAGGATTCCT No data
Right 1062856659 10:783284-783306 CTCCTCTCCACAAGAAGATAAGG No data
1062856656_1062856666 27 Left 1062856656 10:783263-783285 CCACCAGGAAATACAGGATTCCT No data
Right 1062856666 10:783313-783335 TGAACCAGAGCGCGGCCCTGGGG No data
1062856656_1062856663 19 Left 1062856656 10:783263-783285 CCACCAGGAAATACAGGATTCCT No data
Right 1062856663 10:783305-783327 GGGATTCTTGAACCAGAGCGCGG No data
1062856656_1062856660 -1 Left 1062856656 10:783263-783285 CCACCAGGAAATACAGGATTCCT No data
Right 1062856660 10:783285-783307 TCCTCTCCACAAGAAGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062856656 Original CRISPR AGGAATCCTGTATTTCCTGG TGG (reversed) Intergenic
No off target data available for this crispr