ID: 1062858302

View in Genome Browser
Species Human (GRCh38)
Location 10:790534-790556
Sequence CCAGCCCTGAATGGTTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062858302_1062858310 17 Left 1062858302 10:790534-790556 CCTTAAAAACCATTCAGGGCTGG No data
Right 1062858310 10:790574-790596 TGTAATCCCAGTGCTTCGGGAGG 0: 32
1: 2574
2: 21116
3: 331031
4: 331471
1062858302_1062858307 13 Left 1062858302 10:790534-790556 CCTTAAAAACCATTCAGGGCTGG No data
Right 1062858307 10:790570-790592 CACCTGTAATCCCAGTGCTTCGG 0: 699
1: 4874
2: 83630
3: 222908
4: 291335
1062858302_1062858308 14 Left 1062858302 10:790534-790556 CCTTAAAAACCATTCAGGGCTGG No data
Right 1062858308 10:790571-790593 ACCTGTAATCCCAGTGCTTCGGG 0: 18
1: 943
2: 8626
3: 103521
4: 375165
1062858302_1062858311 22 Left 1062858302 10:790534-790556 CCTTAAAAACCATTCAGGGCTGG No data
Right 1062858311 10:790579-790601 TCCCAGTGCTTCGGGAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062858302 Original CRISPR CCAGCCCTGAATGGTTTTTA AGG (reversed) Intergenic
No off target data available for this crispr