ID: 1062859863

View in Genome Browser
Species Human (GRCh38)
Location 10:802997-803019
Sequence CTCTGGGTTTACTGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062859850_1062859863 22 Left 1062859850 10:802952-802974 CCCACTCACACTGCAGGAGCCCC No data
Right 1062859863 10:802997-803019 CTCTGGGTTTACTGAGAAGAGGG No data
1062859851_1062859863 21 Left 1062859851 10:802953-802975 CCACTCACACTGCAGGAGCCCCT No data
Right 1062859863 10:802997-803019 CTCTGGGTTTACTGAGAAGAGGG No data
1062859859_1062859863 -2 Left 1062859859 10:802976-802998 CCAGAGTGGGGCTGGAAGCTTCT No data
Right 1062859863 10:802997-803019 CTCTGGGTTTACTGAGAAGAGGG No data
1062859856_1062859863 3 Left 1062859856 10:802971-802993 CCCCTCCAGAGTGGGGCTGGAAG No data
Right 1062859863 10:802997-803019 CTCTGGGTTTACTGAGAAGAGGG No data
1062859858_1062859863 1 Left 1062859858 10:802973-802995 CCTCCAGAGTGGGGCTGGAAGCT No data
Right 1062859863 10:802997-803019 CTCTGGGTTTACTGAGAAGAGGG No data
1062859857_1062859863 2 Left 1062859857 10:802972-802994 CCCTCCAGAGTGGGGCTGGAAGC No data
Right 1062859863 10:802997-803019 CTCTGGGTTTACTGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062859863 Original CRISPR CTCTGGGTTTACTGAGAAGA GGG Intergenic
No off target data available for this crispr