ID: 1062865047

View in Genome Browser
Species Human (GRCh38)
Location 10:845233-845255
Sequence TTTTTGTTTTGGGGGATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 780
Summary {0: 1, 1: 0, 2: 1, 3: 62, 4: 716}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062865047_1062865053 27 Left 1062865047 10:845233-845255 CCCTTTATCCCCCAAAACAAAAA 0: 1
1: 0
2: 1
3: 62
4: 716
Right 1062865053 10:845283-845305 TCTCATTAGCAGAGTTCAGCAGG No data
1062865047_1062865054 28 Left 1062865047 10:845233-845255 CCCTTTATCCCCCAAAACAAAAA 0: 1
1: 0
2: 1
3: 62
4: 716
Right 1062865054 10:845284-845306 CTCATTAGCAGAGTTCAGCAGGG No data
1062865047_1062865055 29 Left 1062865047 10:845233-845255 CCCTTTATCCCCCAAAACAAAAA 0: 1
1: 0
2: 1
3: 62
4: 716
Right 1062865055 10:845285-845307 TCATTAGCAGAGTTCAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062865047 Original CRISPR TTTTTGTTTTGGGGGATAAA GGG (reversed) Intronic
900566088 1:3332483-3332505 ATTTTGTTTTGGGGGCTTTATGG + Intronic
901335513 1:8445691-8445713 TTTTTATGTTCGGGGATACATGG + Intronic
902075580 1:13782240-13782262 TTTTTTTTTGGGAGGAGAAAGGG - Exonic
902146323 1:14403386-14403408 TTTTTCGTTTGGGGAGTAAAGGG - Intergenic
903318682 1:22528536-22528558 TTCTTTTTTTGGGGGAGACAGGG + Exonic
903792107 1:25900846-25900868 ATGTTGTTTTAGGGGCTAAAGGG - Intronic
904478618 1:30780189-30780211 TTTTTTTTTTGGTAGATACAGGG + Intergenic
905394668 1:37659460-37659482 TCTTTAGTTTGGGAGATAAAAGG + Intergenic
907240355 1:53077670-53077692 TTGTTGTTCTGGGGGATGGAAGG - Exonic
908129163 1:61057534-61057556 TTTTTTTTTAAGGGAATAAAGGG - Intronic
908396762 1:63732295-63732317 TTCTTTTTTTGGGGGGTAAGGGG - Intergenic
908956543 1:69636600-69636622 ATTTTGTTTTTGGCTATAAAGGG + Intronic
909358626 1:74736530-74736552 TTTTTATTTTAGGGTATAAATGG + Exonic
909573237 1:77141969-77141991 CTTTTATTGTGGGGGAAAAATGG - Intronic
909573368 1:77143494-77143516 CTTTTATTATGGGGGAAAAATGG - Intronic
910026234 1:82657733-82657755 TTTTAGTTCTTGGGGATAAAAGG + Intergenic
911143766 1:94533004-94533026 TTTTTGAATTGGGGAAGAAATGG + Intronic
911454013 1:98100584-98100606 TTGTTGTTTGGGGGGTGAAAGGG - Intergenic
911630578 1:100179487-100179509 TTTTTTTTTTGGTAGATACAGGG - Intergenic
911870066 1:103086022-103086044 TTTTTATTTTGGGGTATAGCAGG - Intronic
911893997 1:103406230-103406252 TTTTTGATCTGGTGGGTAAAAGG - Intergenic
912375931 1:109209946-109209968 TTTTTGTTTTGGTAGATACAGGG - Intergenic
912991553 1:114492491-114492513 TTTCTGTTTGGGATGATAAAAGG - Intronic
914842295 1:151258465-151258487 TTTTTTTTTTGGGGGAGACAGGG + Intronic
915527610 1:156485706-156485728 TTTTTTTTTTGGTAGATACAGGG + Intronic
915804141 1:158827116-158827138 TTTTTGTTTGGGGAGAGAAGAGG + Intergenic
916431262 1:164731300-164731322 TTTTTTTTTTGGCTGATGAAAGG - Intronic
917173991 1:172210959-172210981 TTTTTGTTTTGAGGGAGGGAAGG - Intronic
917520609 1:175745390-175745412 TTTTTTTTTTGGGTGAAAAGTGG + Intergenic
917667809 1:177242266-177242288 TTTTATTTTTGGGGGACAGATGG - Intronic
918492813 1:185100188-185100210 TTTTTGTTTTAGGTATTAAATGG + Exonic
918810843 1:189117625-189117647 TTTTTTTTTTGGTGGAGACAGGG + Intergenic
919109515 1:193200052-193200074 TTTTTTTTTTGGTGGAGACAGGG - Intronic
919515966 1:198523557-198523579 GTTTTGTTTTGGTAGATAATGGG - Exonic
919553979 1:199028889-199028911 TTTTTATGTTGGTGAATAAATGG + Intergenic
920036722 1:203070573-203070595 TTTTTTTTTTGAGGGAGACAGGG - Intronic
920094856 1:203479695-203479717 TTTTTTTTTTTGGTGATACAGGG - Intronic
920721903 1:208395531-208395553 CTTTTGTTTTGGGAGATTTAGGG - Intergenic
921027600 1:211301418-211301440 GTTTTGTTTTGGGGGGCAAGGGG - Intronic
921356072 1:214285435-214285457 GAGTTGTTTTGGGGGAGAAATGG + Intronic
921584649 1:216932737-216932759 TTTTTTTTTTGGTAGAGAAAAGG + Intronic
921822375 1:219631831-219631853 TTTTGGTTTTGGGGGCTATACGG - Intergenic
921825505 1:219667711-219667733 TTTTTTTTTTGGTGGAGACAGGG + Intergenic
922805978 1:228389718-228389740 TTTTTTTTTTTGGGGATACAGGG - Intergenic
923230331 1:231980469-231980491 TGTTTGTTTTGGGGGATTTTGGG - Intronic
923296416 1:232598951-232598973 TTTTTTTTTTGAGGGGTAGAGGG - Intergenic
923303022 1:232660652-232660674 TTTTTCTTGTGGGTGAAAAATGG + Intergenic
923434047 1:233951747-233951769 TTTTTGTTTTGAGAGAGAGATGG + Intronic
923662378 1:235969442-235969464 TTTTTGTTCTGGGGGATTTGGGG - Intergenic
924225279 1:241916791-241916813 ATTATGTTTTGGGAGAGAAAAGG + Intergenic
924379353 1:243447406-243447428 CTTTTATTTTGGGGGAGGAAGGG + Intronic
924529061 1:244877996-244878018 TTTTGGTTGAGGGGGATGAAAGG - Intergenic
1062865047 10:845233-845255 TTTTTGTTTTGGGGGATAAAGGG - Intronic
1063170392 10:3504601-3504623 TTTTTTTTTTGGTAGATAAGGGG - Intergenic
1063516777 10:6704376-6704398 TTTTTGTTTTTGGAGAAACAAGG + Intergenic
1063974100 10:11401663-11401685 CTTTTGTTTTGGGGAAAAATGGG + Intergenic
1063985896 10:11501576-11501598 TTTTAGGTGTGTGGGATAAAAGG - Intronic
1064263578 10:13806156-13806178 TTTTTGTTTTGTGGTAGAGATGG + Intronic
1064537688 10:16374520-16374542 TTTTTTTTTTGGTGGAGACAAGG + Intergenic
1064705808 10:18071038-18071060 TTTTTTTTTTGGGAGAGACAGGG - Intergenic
1064836926 10:19543442-19543464 TTTTTTTTTTGAGAGAGAAATGG + Intronic
1064939191 10:20713827-20713849 TTTTTTTTTTGGTCGATACAAGG - Intergenic
1065477278 10:26153528-26153550 TTATTTTTTTGTGTGATAAATGG - Intronic
1065782441 10:29182648-29182670 TTTTTGATTTGGGGGAACATGGG + Intergenic
1066096078 10:32073130-32073152 TTTTTTTTTTGGTGGATCATGGG - Intergenic
1066179125 10:32942689-32942711 TTTTTTTTTGGGGGGAGACAGGG + Intronic
1066207015 10:33199412-33199434 TTTTTTTTTTGGCGGAGACAGGG + Intronic
1067000002 10:42601922-42601944 TTTTTTTTTGGGGGGAGACAGGG + Intronic
1067001751 10:42621147-42621169 TTTTTTTTTTGGTGGAAACAGGG - Intronic
1067116730 10:43441059-43441081 TTTTTTTTTTGGTGGAGACAGGG + Intronic
1067138906 10:43638898-43638920 TTTTTTTTTTGGTGGAGACAGGG + Intergenic
1068673469 10:59746078-59746100 TTTTTATTTTGAGTGAAAAAGGG - Intergenic
1069211553 10:65767588-65767610 CTTTGGTGTTGGAGGATAAAAGG + Intergenic
1069403975 10:68078327-68078349 CTTGTGTTTGGGGGGATAGAAGG - Intergenic
1070242257 10:74694378-74694400 TTTTTTTTTTGGGGTAGAGATGG - Intronic
1070628938 10:78070718-78070740 TTTTTGTATTGCGTGATAAGAGG - Intergenic
1071697802 10:87896481-87896503 TTTTTTGATTGGGGGATAATTGG + Intronic
1071899347 10:90102048-90102070 TATTTGTTTGGGGGAATATAAGG + Intergenic
1072217605 10:93300894-93300916 TTTTTTTTCTGGGGGATAGAAGG + Intergenic
1072264726 10:93716294-93716316 TTTTTTTTTTGGTGGAGACACGG + Intergenic
1072370516 10:94762065-94762087 TGTTTTTTTAGGGGGTTAAATGG + Intronic
1072530179 10:96311648-96311670 TATTTGTTTGGGGGGAGACAGGG + Intronic
1072551954 10:96485873-96485895 CTTTTTCTTTGGGGGAAAAATGG - Intronic
1073200563 10:101731745-101731767 TTTTTTTTTTGGGAGAGAATGGG - Intergenic
1073642300 10:105265036-105265058 TTTTTGTTTCAAGGGTTAAATGG + Exonic
1073945170 10:108741832-108741854 TATTTATTATTGGGGATAAAGGG + Intergenic
1074237131 10:111596732-111596754 TTTTTAATTTGGGGGGTTAAGGG + Intergenic
1074468827 10:113708280-113708302 TTTTTTTTTTAGGGGAAAGAGGG + Intronic
1075044520 10:119135459-119135481 CTTTTGTTGGGGGGGAGAAAAGG + Intronic
1075065985 10:119289192-119289214 GTTTTGTTTTGGGTGCTAAGGGG + Intronic
1075109861 10:119570090-119570112 TTTATTTTAAGGGGGATAAAAGG - Intergenic
1075135205 10:119778394-119778416 TTTTTGGTTTGGGGTCTAATTGG + Intronic
1075350657 10:121721850-121721872 TTTTTGTATTGGAGCACAAAAGG - Intergenic
1075613107 10:123869338-123869360 TGTTTGTTTTAGGGGAGAAATGG - Intronic
1075955251 10:126517956-126517978 TTTTTGCTCTGGAGCATAAAAGG - Intronic
1076220754 10:128731451-128731473 TTTGTGTTTGAGGGGAGAAAGGG + Intergenic
1076892981 10:133293865-133293887 TCTTTGTTTATGGGTATAAAAGG + Intronic
1077277800 11:1724069-1724091 TTTTTTTTTTGGGGTACAGATGG - Intergenic
1077621570 11:3729532-3729554 TTTTTTTTTTTGGAGATACAGGG - Intronic
1077624693 11:3760100-3760122 TTTTTTTTTTGGTGGAGAACAGG - Intronic
1077738459 11:4817625-4817647 TTCATATTTTGGGGGAAAAATGG + Intronic
1077949200 11:6936879-6936901 TTTTTTTTTTTGGTCATAAAAGG - Intronic
1078771516 11:14357114-14357136 TTTTTGTTTTGGGGAAGTAATGG - Intronic
1079240682 11:18720366-18720388 TTTTTTTTTTAGGGGACAATAGG + Intronic
1079795159 11:24792690-24792712 TTTTTGTTTAGTGGTATAACTGG - Intronic
1079976737 11:27101037-27101059 TCATTTTTTTGGGGGATAATGGG - Intronic
1080724144 11:34878339-34878361 TTTATGTTATGGGGCATAATTGG - Intronic
1081215634 11:40393789-40393811 ACTTTGTTTTAGGGGACAAAAGG - Intronic
1081286229 11:41273740-41273762 GTTTTGTTTTGTGGTAAAAATGG - Intronic
1081290204 11:41315420-41315442 TGTTTGTTTTGAGGGAAAACAGG + Intronic
1081554605 11:44146728-44146750 GTTTTGTTTTGTGGTATCAATGG + Intronic
1082079715 11:48002965-48002987 TTTGTGATGGGGGGGATAAAGGG - Intronic
1083170070 11:60918605-60918627 TTTTTTTTTTGGTGGAGAAGGGG + Intronic
1084327277 11:68408257-68408279 TTTTTTTTTTTGGGGAGACAGGG + Intronic
1084341541 11:68506403-68506425 TTTTTTTTTTTGAGTATAAAGGG - Intronic
1084984069 11:72852059-72852081 TTTTTTTTTTGGTAGATAAGGGG + Intronic
1085087335 11:73678727-73678749 TTTTTTTTTTGGGGGGGGAATGG + Intronic
1085559770 11:77460554-77460576 TTTTTTTTTTGGTGAAGAAAAGG + Intronic
1085771418 11:79329431-79329453 CTTTTGTTTTGGTGGAGAGATGG + Intronic
1086149904 11:83597612-83597634 TTTTTTTTTTGGGGTAGAGATGG - Intronic
1086207175 11:84273415-84273437 CATTTCTTTTGGGGGATAACTGG + Intronic
1086823897 11:91471251-91471273 TTTTTCTTTTGAGGAATATAAGG - Intergenic
1087522767 11:99263575-99263597 TTCTTGCTTTGGGGGAAAAAGGG + Intronic
1087600259 11:100305445-100305467 GGCTTCTTTTGGGGGATAAAAGG - Intronic
1087967069 11:104429224-104429246 TTTTTTTTTTAGGGAAAAAAAGG - Intergenic
1088059459 11:105629066-105629088 TTTTTTTTTTGGTGGAGAAGTGG - Intronic
1088691527 11:112332730-112332752 TTTTTGTTGTGGGGGTTATTTGG - Intergenic
1088877474 11:113947979-113948001 TTTTTCTTTGGGGGGATGGAGGG - Intergenic
1089220069 11:116863400-116863422 TTAATCTTTTGGGGGAGAAAGGG + Intronic
1089290142 11:117432779-117432801 TTTTTTTTTTGTGGTAGAAATGG + Intronic
1089394598 11:118128041-118128063 TTTATGTTTTGGGAGAGACAAGG + Intergenic
1090179132 11:124678738-124678760 TTTTTGTTTTGGCAGAGACAGGG + Intronic
1091365285 11:135014784-135014806 TTGTATTTTTGTGGGATAAATGG - Intergenic
1092031630 12:5291001-5291023 TTTTTGTTTTGGGAGTGAATAGG + Intergenic
1092084926 12:5748858-5748880 TTTTTTTTTTGGAGGGTGAAGGG - Intronic
1092216553 12:6688117-6688139 TTCTGGTTTTGGGGGAGAAGGGG - Intronic
1092738163 12:11603534-11603556 TGTTTGTTTTGGGGGGTGGAGGG + Intergenic
1092941167 12:13408500-13408522 TTTTTTAATAGGGGGATAAAGGG - Intergenic
1093067229 12:14670828-14670850 TCTTTTTTTTGGGGAAGAAAAGG + Intronic
1093256023 12:16869020-16869042 TTTTTAGTTTGAGGGATGAAAGG - Intergenic
1094147601 12:27246345-27246367 TTTTTGTTAAGAGGGAGAAAGGG + Intronic
1094226364 12:28050693-28050715 TTTTTTTTTTGAGGTAGAAAGGG - Intergenic
1094256131 12:28428563-28428585 TTTTTTTTTTTGGGGAGAGACGG - Intronic
1095145005 12:38716612-38716634 TTTTTGTATTAGGTGAGAAATGG - Intronic
1095304414 12:40622793-40622815 TTTTTGTTTTTGTAGAGAAAGGG - Intergenic
1096681675 12:53259759-53259781 TTTTTTTTTTGGGGGGGACAGGG + Intergenic
1096811770 12:54175136-54175158 TTCTTGTTTAGGAGGATATAGGG - Intronic
1096879172 12:54653599-54653621 TTTAAGTGTTGGGGGAAAAAAGG - Intergenic
1097038163 12:56137711-56137733 TTTTGGGATTGGGGGAAAAATGG - Intronic
1097415457 12:59310601-59310623 TTTTAGATTTGAGGGTTAAATGG + Intergenic
1097832438 12:64239852-64239874 TTTTTGTTTTGGTAGAGACAGGG - Intergenic
1098228423 12:68348463-68348485 CTGCTGTTTTGGGGGATAATTGG - Intergenic
1098381059 12:69869989-69870011 TTTGTCTTTTGGAGGATGAACGG - Intronic
1098386566 12:69925623-69925645 TTTTTGTTATGGCTGAGAAATGG + Intronic
1098902468 12:76126890-76126912 TTTTTTTTTTGGGAGAGAAGGGG + Intergenic
1099035971 12:77588289-77588311 TTTTTTTTTTGGTAGAGAAAGGG + Intergenic
1099117970 12:78650956-78650978 TTTTTGTTTTGGTAGAGAAAAGG - Intergenic
1099209454 12:79766310-79766332 TTTTTGTTTGGGGGGAGATAAGG - Intergenic
1099497526 12:83369130-83369152 TTTTTTTTTTGGTAGATACAGGG - Intergenic
1100138772 12:91590416-91590438 TCTGTGTTTTGGGGGAGAATTGG - Intergenic
1100649787 12:96572771-96572793 TTTCTATTTTGGGGTAGAAATGG + Intronic
1100692401 12:97052406-97052428 TTTTTGGCTTGGGGAAAAAAAGG - Intergenic
1101300819 12:103478594-103478616 TTTTTTTTTTGGGGGAGACAGGG + Intronic
1101766185 12:107701683-107701705 TTTTTGTTTTGTGTGAGACAGGG + Intronic
1102584127 12:113911248-113911270 ATTTCCTTTTGGGGGATAAAGGG + Intronic
1103006566 12:117425391-117425413 TTTTTTTTTTTGGGGAGACAAGG - Intronic
1103660585 12:122512372-122512394 TTTTTGTTTTGGGGCACTATGGG + Intronic
1103770257 12:123317008-123317030 CTTTTCTTTTGGTGGAGAAAGGG + Intronic
1104261156 12:127183364-127183386 TTTTTTTTTTGGGGGGGAAAGGG + Intergenic
1105225325 13:18426333-18426355 CTTTTGGTTTGTGGGGTAAAGGG + Intergenic
1106739482 13:32624185-32624207 TGTATAATTTGGGGGATAAAAGG - Intronic
1107030155 13:35842496-35842518 TTTTTGTTTTTGGAGAGACAGGG - Intronic
1107721241 13:43250564-43250586 ATTTTCTTTTGGGGGCTGAATGG + Intronic
1107929251 13:45293493-45293515 TTTTTTTTTTGGTGGGGAAAGGG + Intergenic
1108637404 13:52349379-52349401 TTTTTGTTTTGGTGCTCAAAGGG - Intergenic
1109133658 13:58620500-58620522 TTTTTGCATTAGGGGAAAAAAGG + Intergenic
1109630354 13:65036987-65037009 GTTATGTTTTGGAAGATAAAAGG + Intergenic
1110283426 13:73721723-73721745 TTTTTTTTTTGGTAGAGAAAGGG + Intronic
1110427329 13:75383314-75383336 TTTTTGTTGTTGGGGAGACAAGG - Intronic
1110668071 13:78141625-78141647 TTTTTTTTTTGGTGGAGACAGGG + Intergenic
1110895973 13:80753146-80753168 TTTTTTTTTTAGTGGATACAAGG + Intergenic
1111184327 13:84711633-84711655 TTGTTCTTTTAGAGGATAAATGG + Intergenic
1111340374 13:86877775-86877797 TTTTTCTTTTGGTGATTAAATGG + Intergenic
1111430856 13:88146767-88146789 TTTTTGTTTGTGGCAATAAATGG - Intergenic
1112425071 13:99290716-99290738 TTTTTTTTTTGGTGGTGAAACGG - Intronic
1112658883 13:101484192-101484214 TTTTTATTTTTGTGGTTAAAAGG + Intronic
1112956439 13:105064644-105064666 CTCTTGTTTTGGGGAAGAAACGG + Intergenic
1113819172 13:113199868-113199890 TTTTTCTTTTGGAAGAAAAATGG - Intronic
1113865232 13:113517513-113517535 TTTTTGTATTAGTGAATAAATGG + Intronic
1114009793 14:18354681-18354703 CTTTTGGTTTGTGGGGTAAATGG + Intergenic
1114287226 14:21256443-21256465 TTTTTTTTTTGGGGGGGAGATGG - Intronic
1114325183 14:21581790-21581812 TTTTTTTTTTGGTAGAGAAAGGG - Intergenic
1114867057 14:26608757-26608779 TTTTTATTTGAGGTGATAAAAGG - Intergenic
1115094444 14:29618058-29618080 TTTTTGTTTTTTGGGAGAAGGGG - Intronic
1115489080 14:33941545-33941567 TTTTTTTTGGGGGGGATAGAGGG - Intronic
1115662106 14:35506817-35506839 TTTTCTTTTTGGGGGAGAAGAGG + Intergenic
1115685873 14:35795802-35795824 TTTTTTTTTTGGTAGAGAAATGG - Intronic
1115805287 14:37043948-37043970 TTTTTTTTTTGGTGGAGACATGG + Intronic
1115837646 14:37426913-37426935 TTTTTGTTTTAGGAGAAACATGG - Intronic
1115877881 14:37881056-37881078 TTGTTGCTCTGGGGGAAAAAGGG - Intronic
1115982105 14:39064738-39064760 TTCTTTTTTGGGGGGATAACAGG + Intronic
1115984541 14:39090342-39090364 TGTTTGTATTGGGGGATAGTTGG - Intronic
1116004271 14:39275720-39275742 TTTTGCTATTGGGGGAAAAAAGG - Intronic
1116072287 14:40063402-40063424 TTTTTTTTTTGGGGTAGAGATGG + Intergenic
1116505352 14:45670988-45671010 TCATTAGTTTGGGGGATAAATGG + Intergenic
1116696604 14:48185260-48185282 TTTTTGCTTTTGGTGAGAAAAGG + Intergenic
1116920612 14:50569180-50569202 TTTTTTTTTTTGTGGAGAAAGGG - Intronic
1117051817 14:51867800-51867822 TTTTTTTATTGGGGAAAAAAGGG - Intronic
1117083270 14:52173774-52173796 TTCTTTTTTTGGGGGATAGGTGG - Intergenic
1117130020 14:52676863-52676885 TTTTTTTTTTGGGGTAGATAGGG - Intronic
1118137013 14:63040946-63040968 TTTTCTTTTTGGGGAAAAAAGGG - Intronic
1118137014 14:63040947-63040969 TTTTTCTTTTTGGGGAAAAAAGG - Intronic
1118433744 14:65749745-65749767 TTGTTGTTTTGGGAAATAACAGG + Intergenic
1118594602 14:67425917-67425939 TTTTTTTTTTGGTGGAGACAGGG + Intergenic
1119625331 14:76169400-76169422 ATTTTGTTTGGGGGAAAAAAAGG - Intronic
1119960242 14:78847723-78847745 TTTTGATAGTGGGGGATAAAAGG - Intronic
1120157357 14:81108496-81108518 TTTTTTTTTTTTGGAATAAATGG + Intronic
1120460220 14:84785707-84785729 TTTTTTTTTTGGTGGAGAGAGGG - Intergenic
1120749145 14:88181684-88181706 TTTGTCTTTTGGGGGATTAATGG - Intronic
1120897756 14:89549543-89549565 CTTCTGTTTTGGGGGATATTGGG - Intronic
1122165633 14:99821491-99821513 TTTTTGTTTTAAGAGACAAAAGG - Intronic
1122194251 14:100073326-100073348 TTTTTTTTTTTGGGGAGACAGGG + Intronic
1123433186 15:20235569-20235591 TTTTTGTTTTAGTGGAGACAGGG - Intergenic
1123753508 15:23378017-23378039 TTTTTTTTTTGGTAGAGAAAAGG - Intergenic
1125798081 15:42419051-42419073 TTTTTTTTTTGGTAGAGAAAGGG - Intronic
1125873214 15:43121173-43121195 TTTTTTTTTTGGTAGAGAAAGGG - Intronic
1125911856 15:43447236-43447258 TTTTTGTTTTAGGGAAAATAGGG - Intronic
1126453304 15:48833965-48833987 TGTTTCTTTTGGGGGAACAAGGG + Intronic
1126777956 15:52115585-52115607 TTTTGGTTTTGGCTGATAATGGG - Exonic
1126820625 15:52500190-52500212 TTTTTGTTTTGTGTGATAATAGG + Intronic
1127356047 15:58201051-58201073 TTTTTTTTTTGGTGGGGAAAAGG - Intronic
1127541462 15:59942933-59942955 TGTGTGTGTTGGGGGATGAAAGG - Intergenic
1127792304 15:62408982-62409004 TTTATTTTTTGGGGGGTACAGGG + Intronic
1127818235 15:62631751-62631773 TTTTTGTTTTTTGGTATAGACGG + Intronic
1127939286 15:63677594-63677616 GTTTTGTTTTGGGGAAAAAATGG - Intronic
1128776610 15:70325121-70325143 CTTTTGTTTTGTTGAATAAAAGG - Intergenic
1128863899 15:71098205-71098227 TTTTTTTTTGGGGGGAGAGAAGG + Intronic
1129040603 15:72683113-72683135 TTTTTGATCTGGTGGTTAAAGGG + Intronic
1129629683 15:77245176-77245198 TTTTTGTTTTCGGTCTTAAATGG + Intronic
1129856131 15:78826551-78826573 TTTTTTTTTTGGTAGAGAAAGGG + Intronic
1130990026 15:88870709-88870731 TTTTTATTTTGGGGGTGAATGGG - Intronic
1131382958 15:91979556-91979578 TTTTTTTTTCCGTGGATAAATGG - Intronic
1131554992 15:93389796-93389818 TTTTTTTTTTTGGAGAGAAAAGG + Intergenic
1132362139 15:101225238-101225260 TTTTTTTTTTGGCAGATACAGGG + Intronic
1133085558 16:3359867-3359889 TTTTTTTTTTGGTGGAGACAGGG + Intergenic
1133753658 16:8745150-8745172 TTTTTGTTTTGTGGTAGAGATGG + Intronic
1134061280 16:11201137-11201159 GTTTTGTTTTGAGGGATACAGGG + Intergenic
1134617809 16:15665062-15665084 TTTTTTTTTTGGCGGAAACAGGG + Intronic
1135862973 16:26074215-26074237 TTTTCATTTTGGAAGATAAAAGG - Intronic
1135955604 16:26954088-26954110 TTCTTGATTTGGGGGATCAATGG - Intergenic
1137633512 16:49965698-49965720 TTACTGTTTTGGAGTATAAAGGG + Intergenic
1138226612 16:55301188-55301210 TTTTTGGATTGGGGTATCAAGGG - Intergenic
1138893672 16:61176551-61176573 TTTTTGATTTGGGACATAAATGG + Intergenic
1139082448 16:63539574-63539596 TTTTTTTTATGTGGGGTAAAAGG + Intergenic
1139313202 16:66044466-66044488 TTTTCTTTTGGGGGGATTAAGGG - Intergenic
1139806682 16:69571700-69571722 TTTTTTTTTGGGGGGAAACAAGG + Intronic
1140601383 16:76479769-76479791 TTTTTGTTTGGGGACATAATTGG - Intronic
1141070871 16:80953391-80953413 TATTGGTTTTGGAGTATAAAAGG - Intergenic
1141297839 16:82786409-82786431 TTTCTGATTTGGAGGATCAAAGG - Intronic
1141520110 16:84572923-84572945 TTTTTTTTTTGGTAGATAATGGG + Intronic
1142498732 17:320630-320652 TTTTTTTTTTGGGGGGGACAGGG - Intronic
1142524468 17:529857-529879 TTTTTTTTTTGGTAGATATAGGG - Intronic
1142547282 17:713868-713890 TTTTTTTTTTGGGGTAAAGACGG - Intronic
1142921193 17:3188338-3188360 TTTTCTCTTTGGGGGATAAGTGG + Intergenic
1143190631 17:5037512-5037534 TTTTTGTTTGGGGGGGTGGATGG - Intronic
1143694846 17:8605955-8605977 TTTTTGTTTTGGAAAATACAGGG + Intronic
1143734521 17:8901105-8901127 TGTTTGTTTTGGGGGACAGTGGG + Intronic
1144114900 17:12078380-12078402 TTTTTATTTTGGGGGGTACATGG + Intronic
1145045710 17:19614046-19614068 CTTTTGTTTTGGGGGATAGGTGG - Intergenic
1146187601 17:30735445-30735467 TTTTTGTTTTAGGAGAGATAGGG - Intergenic
1146332657 17:31940838-31940860 TTTTTGTTTTAGTAGATACAGGG - Intronic
1147017630 17:37505110-37505132 TTTGAGTTTTGGGGTAGAAATGG + Intronic
1147127085 17:38378505-38378527 TTTCTTTTTTGGGGGAGACAGGG - Intronic
1148539212 17:48466477-48466499 TTTTTCTTTTGGGAGATCACTGG + Intergenic
1149430593 17:56593585-56593607 TTGTTGTTTGGGGGGAAGAAGGG + Intergenic
1149568190 17:57653941-57653963 TTTTTTTTTTTCGGGATCAATGG + Intronic
1149706973 17:58703950-58703972 TTTTTTTTTTTGGGTAGAAATGG + Intronic
1149926473 17:60706814-60706836 TTTTTTTTTTGGTGGAGACAGGG + Intronic
1150169890 17:62982346-62982368 TTTTTGTTTTTAAGTATAAAGGG - Intergenic
1150585090 17:66510266-66510288 ATTTTGTTTTCGGGGGGAAAAGG + Intronic
1151168720 17:72227386-72227408 TTTATATTTTGGGGGTTATATGG + Intergenic
1151831479 17:76554718-76554740 CTTTTGTTTTCGGGGAGGAAGGG - Intergenic
1151896714 17:76985728-76985750 TTTCAGTTTTGCGAGATAAAGGG + Intergenic
1152788533 17:82265183-82265205 TTTTTTTTTTGGGGGGGACAGGG + Intronic
1153449888 18:5215496-5215518 TTTTTTTTTTGGTGGAGACAGGG - Intergenic
1153458807 18:5311073-5311095 TTTTTGTTTTGGGGAAATAGAGG - Intergenic
1153578616 18:6548926-6548948 TTTTTGGTGTGGGAGACAAAAGG - Intronic
1154100440 18:11468154-11468176 TTTTTGTTGTGGTGGATTCATGG - Intergenic
1154493733 18:14940725-14940747 TTTCTGTTGTGGGGCATAACGGG + Intergenic
1154528046 18:15313188-15313210 CTTTTGGTTTGTGGGGTAAAGGG - Intergenic
1155209914 18:23591627-23591649 TTTTTTTTTTGAAGGAAAAAGGG - Intergenic
1155719087 18:28988100-28988122 TTTTTTTTTTGGGGGAGGATGGG + Intergenic
1155826192 18:30446351-30446373 TTATTGTTTTTGAGGATAAAGGG + Intergenic
1156934747 18:42690077-42690099 TTTTGTGTTTGGGGGAAAAAAGG + Intergenic
1156934748 18:42690078-42690100 TTTGTGTTTGGGGGAAAAAAGGG + Intergenic
1157235423 18:45960833-45960855 TTTAAGTTTTGGGAAATAAATGG + Intronic
1157657960 18:49410635-49410657 TTTTTTTTTTGGTAGAGAAAAGG - Intronic
1157685814 18:49641406-49641428 TTTTTGATTGGAGGGAAAAATGG + Intergenic
1157800452 18:50616165-50616187 TCTTCCTTTGGGGGGATAAAAGG + Intronic
1158066154 18:53411252-53411274 TTATTTTTCTGGGGGACAAATGG + Intronic
1158502533 18:58016268-58016290 TTTTTGGCTGAGGGGATAAAGGG - Intergenic
1158529731 18:58248196-58248218 TCTTAGTTTTGGGGGATATCTGG + Intronic
1158906146 18:62013812-62013834 TTTCTGTTTAGTGGGATTAAAGG - Intergenic
1158986358 18:62821540-62821562 TTTTTTTTTTTTTGGATAAAGGG - Intronic
1159576598 18:70186068-70186090 TTTTTTTTTTGGGGGGGAGAGGG - Intronic
1159826684 18:73221243-73221265 TTTTTATTTTCTGGTATAAACGG + Intronic
1160357857 18:78243896-78243918 TTTTTTTCTTGGGGTATAAAAGG + Intergenic
1162218661 19:9157698-9157720 TTTTTATTTTTGGTGATGAAGGG + Intronic
1162316818 19:9944231-9944253 TTTTTTTTTTGGGGGGGAGATGG + Intergenic
1162619010 19:11825675-11825697 TTTTTGTTTTGTGAGAGACAGGG + Intronic
1162627781 19:11899322-11899344 TTTTTGTTTTGTGAGAGACAGGG + Intronic
1164055794 19:21621234-21621256 TTTGTGGTTTGGGGGCTATAGGG - Intergenic
1164900694 19:31919477-31919499 TTATTGTTTTAATGGATAAATGG + Intergenic
1165164954 19:33846230-33846252 TTTTTATTTTGGGGGAGTAGGGG - Intergenic
1165436630 19:35798873-35798895 TTTTTTTTTTGAGAGATAATGGG + Intergenic
1165539439 19:36479867-36479889 TTTTTGTTTTGGTAGAGACAGGG + Intronic
1166074271 19:40404573-40404595 TTTTTTTGTTGGGGGAGACAGGG + Intronic
1167568164 19:50270038-50270060 TTTTTGTTTTTGTAGAGAAAGGG - Intronic
1168076507 19:53983073-53983095 TTATTTTTTTGGGGGATCTATGG + Exonic
926340122 2:11898447-11898469 TTTTTTTTTTGTTGGATACAGGG - Intergenic
926403199 2:12521662-12521684 TTTTTTTTTTGGAGGGAAAATGG + Intergenic
926983249 2:18593917-18593939 TTTGTTTCTTGGGGGAAAAAAGG - Intergenic
927946173 2:27136638-27136660 TTTTTGTTTTTGGAGAGACAGGG + Intergenic
928601153 2:32904752-32904774 TTTCTGTTATAGAGGATAAAGGG + Intergenic
928744298 2:34393620-34393642 TTTTTTTTTTGGTGGACATATGG + Intergenic
928793328 2:34985353-34985375 TGTGTGTTTTGGGGGAAAAAAGG + Intergenic
929117759 2:38458501-38458523 GAGTTGTTTTGGGGGAAAAAAGG - Intergenic
929365426 2:41150079-41150101 TTTTTGTTTTGTGATATAATTGG + Intergenic
929895813 2:45960116-45960138 TGCTTGTTTTCTGGGATAAAGGG + Intronic
930049571 2:47204648-47204670 TTTTTTTTTTGGGGGGGACAAGG - Intergenic
931340313 2:61394944-61394966 TGTTTGTTTTGTGGGAAAAATGG - Exonic
931346624 2:61452709-61452731 TTTTTTTTTTGGTGGAGACAGGG - Intronic
931394960 2:61879448-61879470 TTTTTTTTTTGGTGGAGACAGGG + Intronic
931786123 2:65620910-65620932 TTTTTTTTTTTGTGGATAACAGG + Intergenic
932200517 2:69822802-69822824 TTTCTGTTTGGGGTGATGAAAGG + Intronic
932380490 2:71277323-71277345 TTATTATTTAGGGGGGTAAAGGG - Intronic
932521212 2:72414916-72414938 TTTTTGTTTTGGTAGAGACAAGG + Intronic
932600625 2:73122470-73122492 CTTTTGTTTTGGTAGAGAAAAGG - Intronic
932930421 2:76030049-76030071 TTTTTGTATATGGTGATAAAAGG + Intergenic
933325220 2:80827095-80827117 TTTGTTTCATGGGGGATAAAAGG + Intergenic
934863002 2:97780011-97780033 TTTTTGTTTTTTTGGAGAAAAGG - Intronic
935523944 2:104143087-104143109 TTTTTTTTTTGGTGGATATGGGG - Intergenic
936852515 2:116917917-116917939 GTTTTGTTTAGGGTGCTAAAAGG - Intergenic
937180017 2:119986491-119986513 TTTTTGTTTTGGGGGCTGACGGG + Intergenic
937796785 2:126032518-126032540 TTTTTGTTTTGGCAGATTAAAGG - Intergenic
938527149 2:132144647-132144669 CTTTTGGTTTGTGGGGTAAAGGG - Intergenic
938849286 2:135244095-135244117 TTTTTTTTTTGGTGGGGAAATGG - Intronic
938935779 2:136126356-136126378 GTTTTATCTTGGGTGATAAATGG + Intergenic
939223414 2:139334435-139334457 TTTTTATTTTGTGTGATCAAAGG - Intergenic
939464757 2:142543203-142543225 ATTATGTTTTGGGGGATGACAGG - Intergenic
940031136 2:149262672-149262694 TCTGTGTTTTGGGGGATATTAGG + Intergenic
940375326 2:152951595-152951617 TTTTTGTTTCAGTAGATAAAGGG - Intergenic
941275886 2:163490201-163490223 ATTTTATTTTGGGGAAAAAATGG - Intergenic
941279121 2:163527994-163528016 TTTTTGTTTGGAGTCATAAAAGG + Intergenic
941403196 2:165057092-165057114 TTTTTGTTTTGGAAAATAGAGGG - Intergenic
941571945 2:167181628-167181650 TATTTGTTCTGGAGGAAAAAAGG - Intronic
941707318 2:168673498-168673520 TTTGTCTTTTGGGAGAAAAATGG + Intronic
941994234 2:171586364-171586386 ATCTTCTTATGGGGGATAAAGGG + Intergenic
942280821 2:174362297-174362319 TTTTTGTTTTTGTTGAGAAAAGG - Intronic
942562477 2:177235251-177235273 TTTTTGTTTTGGTAGAAACAGGG - Intronic
942622751 2:177865276-177865298 TTGTTTTTTTGGGGGATGCAGGG - Intronic
942817612 2:180070823-180070845 TTTTTATTTTGATGGATTAAAGG + Intergenic
943374399 2:187057079-187057101 TTTTTGGTTTGGGGGCCATATGG - Intergenic
943497781 2:188645786-188645808 TTTTTGTTTTGTTGTAAAAATGG + Intergenic
944069366 2:195652375-195652397 TTTGTATTTTGGGGGAGAGACGG - Intronic
944204340 2:197141724-197141746 TTTTTGTTATGGGGGAGAGGAGG - Intronic
944818600 2:203405707-203405729 TTTTTTTTTGGGGGGGTAATTGG + Intronic
944912248 2:204322307-204322329 TTTTTGGTTGGGGGGATAGAGGG - Intergenic
944923760 2:204441794-204441816 GCTTTGGTTTGGGGGACAAAAGG + Intergenic
946003170 2:216499819-216499841 TTTTGTTTTTGAGGGAGAAAGGG + Intronic
946589789 2:221232711-221232733 TTTTTTTTTTGGTAGGTAAATGG + Intergenic
946610529 2:221453058-221453080 TTTTTGTTTTTTGGTATAAGTGG - Intronic
946916199 2:224524778-224524800 GTTTTGTTTTGTGGGGGAAACGG - Intronic
947073642 2:226318388-226318410 TTTTTTTTTTTTGAGATAAAAGG - Intergenic
947236377 2:227945554-227945576 TTTATGTTTTGGTGGGTAAGGGG + Intergenic
947507179 2:230716827-230716849 TTTTTATTTTTGTGGATATAGGG - Intronic
947549089 2:231033609-231033631 TGTTTGATTTGGGGGCTAAAAGG - Intergenic
947563297 2:231176867-231176889 TTTTTTTTTTGGTGGAGACAGGG - Intergenic
947845797 2:233242766-233242788 TTTCTGTTTAGGGGGAAAAGAGG + Intronic
1169007089 20:2216746-2216768 TTTTTTTTTTGGGGGGGACAGGG + Intergenic
1169043172 20:2512907-2512929 TTTTTTTTTTGGTAGAGAAATGG - Intronic
1169350351 20:4863494-4863516 GTTTTGTTTTGAGGATTAAACGG + Intronic
1169986603 20:11452056-11452078 TTGTTGTTTTGGGGGAAATTTGG + Intergenic
1170015439 20:11776138-11776160 TATGGGTTTTGGGGAATAAAAGG - Intergenic
1170028961 20:11924068-11924090 TATCTGTTTTGGGGGGTAAGAGG - Exonic
1170634102 20:18090010-18090032 TTTTTGTTTTGTGTGAGACAGGG + Intergenic
1172470493 20:35190463-35190485 TTTTTGTTTGGGTGGGAAAAGGG - Intergenic
1173381448 20:42546746-42546768 TTTTTGTTTCGGGGAATATGGGG + Intronic
1173396746 20:42687439-42687461 TTGAGGTTTTGGGGGATAAGGGG - Intronic
1174022506 20:47542209-47542231 TTTTTTTTTTGGTGGAAAAGGGG + Intronic
1174650128 20:52117968-52117990 TTTTTGGTTTGGGAGAGACAAGG + Intronic
1175234423 20:57500095-57500117 TTTTTTTTTTGGTGGATGGAGGG + Intronic
1175569238 20:60006534-60006556 TCTTTGTGTTGGGGGAGAGAGGG - Intronic
1175864423 20:62167384-62167406 TTTTTTTTTCGGGAGAGAAAGGG - Intronic
1177060289 21:16365096-16365118 TTTTTGCTTTTGCAGATAAAAGG + Intergenic
1177674715 21:24281678-24281700 ATTCTGTTTTGGGGTATAGAGGG - Intergenic
1177756282 21:25351931-25351953 TTTTTTTTTTGGAGGAAGAAGGG - Intergenic
1178287142 21:31335097-31335119 TTTTTGTTTTGTGGCACAAACGG - Intronic
1178419923 21:32435222-32435244 TTTTTTTTGTGGGGGGGAAATGG + Intronic
1178614156 21:34115924-34115946 TTTTTTTTTTGGAAGATACATGG + Intronic
1178911245 21:36675312-36675334 TTTTTGTTTTTGGAGAGAAGGGG + Intergenic
1179044482 21:37832318-37832340 CTTTTGTCCCGGGGGATAAAGGG + Intronic
1179375386 21:40846437-40846459 TTTATTTTTTGGGGGAGAAGAGG - Intronic
1180434293 22:15285490-15285512 CTTTTGGTTTGTGGGGTAAATGG + Intergenic
1180516480 22:16149300-16149322 CTTTTGGTTTGTGGGGTAAAGGG + Intergenic
1180590791 22:16935508-16935530 TACTTGTTTTGAGGGAAAAACGG + Intergenic
1180698753 22:17770408-17770430 CTTTGGTTTTGGGGGAGAATGGG + Intronic
1181552110 22:23645826-23645848 TTTTTTTTTTGGGGGGGACAGGG + Intergenic
1182180641 22:28344594-28344616 TTTTTGGGTTGGGGCATAAATGG - Intronic
1182184118 22:28384258-28384280 TTTTTGTTTTGGTAGAGACAAGG + Intronic
1183141484 22:35945328-35945350 TTTTTGAATTGGGACATAAAAGG + Intronic
1183564746 22:38605879-38605901 TTATTTTTTTGAGGGAGAAATGG - Intronic
1183877938 22:40799972-40799994 TTTTGGTTTTGGGGGTTATCAGG - Intronic
1184473900 22:44710549-44710571 TTTCTGTTTTGGGAGATGACAGG + Intronic
1184808233 22:46810430-46810452 TTTTTTTTTTGAGTGAGAAAAGG - Intronic
949094201 3:66398-66420 TTTTTTTTTTGCTGAATAAAAGG - Intergenic
949172087 3:1012757-1012779 TTTTTTTTTTGGCAGATACAGGG - Intergenic
949272467 3:2234972-2234994 TTATTTTTTTGGGGAAAAAAAGG + Intronic
950034000 3:9871357-9871379 TTTTTTTTTTGGTGGAGACAGGG + Intronic
950067240 3:10122532-10122554 TTTTTGTTTTGGTAGATATGGGG - Intronic
950318331 3:12025654-12025676 TTTTTGTTTTGGTGGATGGGGGG + Intronic
950707300 3:14790945-14790967 TTTTTTTTTTGGTGGAGACAGGG + Intergenic
951229541 3:20161001-20161023 TTTATGTGTTGGGGGAGAGATGG - Exonic
951556859 3:23929612-23929634 TTTTTGTTTTTGTAGAGAAAGGG + Intronic
951599489 3:24357334-24357356 TTTTTTTTTTGGGAGAGACAAGG - Intronic
951965491 3:28379859-28379881 TTTCTGTTTTGGGGGTCAAAGGG + Intronic
952229735 3:31417279-31417301 TGTATGTTTTGGTGAATAAAAGG - Intergenic
952411630 3:33054778-33054800 TTTTTGTTTTAGAGGAGGAAGGG - Intronic
952567558 3:34677525-34677547 TTTTTCTTTTGGGGGAGGAGGGG + Intergenic
953281049 3:41557591-41557613 TTTTTTTTTTGGTGGAGACAGGG - Intronic
953964772 3:47295750-47295772 TTTTTTTTTTGGTAGATACAGGG + Intronic
954030334 3:47814894-47814916 TTTTTTTTTTGGTGGAAACAGGG + Intronic
954261818 3:49444674-49444696 TTTTTTTTTTGGTGGAGAATGGG + Intergenic
954861109 3:53691153-53691175 TTTTTTTTTTGGGGGGGAGATGG + Intronic
954958915 3:54547572-54547594 TTTATGTTTTGGGGGCTGAATGG + Intronic
955243132 3:57198943-57198965 TTTTTGTTTTTAGGGAAAGATGG - Exonic
956115031 3:65909687-65909709 TTTTAATTTTTGGGGATACAGGG - Intronic
957188012 3:76967715-76967737 TTTTTGTTTTTGGAGATGGAGGG + Intronic
957226290 3:77452101-77452123 TTTTTGTCTAGGGGGAAAGATGG - Intronic
957280630 3:78146781-78146803 TTTATGTATTGGGGAAGAAAAGG - Intergenic
958689620 3:97447053-97447075 TTTATTATTTGGGGTATAAATGG + Intronic
959440995 3:106375300-106375322 TTTTTTTTTTTTGGAATAAAAGG + Intergenic
959459841 3:106612173-106612195 TTATTGTTTTGGAGGAAAGAAGG - Intergenic
959673901 3:109012145-109012167 TTGTTATTTTGGGGGATATATGG + Intronic
959845264 3:111025171-111025193 TTTTTTTTTTTGGAGATAGATGG + Intergenic
960110544 3:113840566-113840588 TTTTTATTTTGGTAGATACAGGG - Intronic
960331902 3:116370182-116370204 ATAGTGTTTTGGGGAATAAAAGG + Intronic
960365957 3:116772606-116772628 TAAATATTTTGGGGGATAAAAGG - Intronic
960975896 3:123173453-123173475 TTTCTGGTTTGGGGGCAAAATGG - Intronic
960991163 3:123312502-123312524 TTTCTGTTTGGGGTGATGAAAGG - Intronic
962680760 3:137797359-137797381 TTATTGTTAAGGGGAATAAAAGG + Intergenic
963829377 3:149990570-149990592 TCTTTCTTTTTGGGGATAGAGGG - Intronic
963959002 3:151287037-151287059 GGTTTGTTTTGGGGATTAAATGG + Intronic
964157281 3:153601540-153601562 TTTTTGTTGTTTGAGATAAAAGG - Intergenic
965254566 3:166389227-166389249 TTTTTTTTTTTGGAGAGAAAGGG - Intergenic
965392305 3:168119797-168119819 TTTTAACTTTGGGGGAAAAAGGG + Intergenic
965698183 3:171431235-171431257 TTGTTGATATGGGGGATAAATGG - Intronic
966091015 3:176136421-176136443 TTTTAGGTTTTGGGGATACATGG + Intergenic
966578692 3:181534454-181534476 TTTTTTTTTTTGCAGATAAATGG - Intergenic
966693867 3:182769402-182769424 TTCCTATTTAGGGGGATAAATGG + Intergenic
967395024 3:188998575-188998597 TTTTTGTTTCAATGGATAAATGG + Intronic
967516254 3:190372469-190372491 TTTTTATTTTGGGGGGGAAGGGG - Intronic
967564368 3:190956437-190956459 TTTAGGTTTAGGGGGATACATGG - Intergenic
967655225 3:192040230-192040252 TTTTGGTATTGGAGGATACATGG + Intergenic
968340849 3:197954338-197954360 TTTTTTTTTGGGGGGAGACAGGG + Intronic
968423549 4:505447-505469 TTTTTTTTTTGGTAGATACAGGG - Intronic
969358228 4:6644042-6644064 TTTTTGTTTTTGGTGAGACAGGG + Intergenic
969668841 4:8578448-8578470 TTTTCTTTTTGGAAGATAAAAGG + Intronic
969820698 4:9718002-9718024 TTTTTTTTGTGGGGGGGAAAGGG + Intergenic
970236513 4:13964229-13964251 TTTTTTTTTTGGAGTAGAAAAGG + Intergenic
970354580 4:15239192-15239214 TGTTTGGGTTGGGGGACAAATGG + Intergenic
970912905 4:21298565-21298587 GTTTTGCTTTGGGAGACAAATGG - Intronic
970950242 4:21747188-21747210 TTTTATTTCTGGGGCATAAATGG - Intronic
971493529 4:27239583-27239605 TTATTGTGTTGGGGGCTGAAGGG + Intergenic
972375591 4:38466618-38466640 TTTTTCTTTTGGGGGCCACAGGG - Intergenic
972526268 4:39915358-39915380 TTTTTTTTTTGGGTGAGACAAGG + Intronic
972902246 4:43699860-43699882 TTTTTGTTTTGGGGAAAGTAGGG - Intergenic
974509688 4:62822732-62822754 GTTTTATATTGGGGGAGAAAAGG - Intergenic
975415120 4:74097007-74097029 GTTTTATTTTGGGGGAAACAAGG - Intergenic
975664636 4:76722792-76722814 TTTCTTTTTTGGGGGATATGGGG + Intronic
975701584 4:77072440-77072462 TTTTTTTTTTGGTGGAGACAGGG - Intronic
976008381 4:80458091-80458113 TTTTTTTTCTGGAGTATAAACGG - Intronic
976221213 4:82758289-82758311 TTTTTGTTTTTGGAGAGACAGGG - Intronic
976781665 4:88766101-88766123 GTTTTCTTTTGTGAGATAAAAGG - Intronic
977025016 4:91807565-91807587 TTTTTGTATAGGGTGAAAAATGG + Intergenic
977495548 4:97770927-97770949 TTTTTGTTTGGGTGGTTAATAGG - Intronic
977650479 4:99462957-99462979 TTTTAGTTTAGGGAGGTAAATGG + Intergenic
977957996 4:103052688-103052710 TTTTTGTTTTGGGGGATATGAGG + Intronic
978103565 4:104873676-104873698 ATTTTCTGTTGGGGGAGAAAAGG + Intergenic
978664592 4:111167357-111167379 TTTTAGTTCTGTGGGATAAGTGG - Intergenic
978867540 4:113532309-113532331 TGTTTGTTTTGGGGGAAGATTGG + Intronic
979476787 4:121168006-121168028 TTTTTGATCTGGAGAATAAAAGG - Intronic
979677162 4:123422506-123422528 TCTTTCTTTTAGGGGATAAGTGG - Intergenic
979719819 4:123885679-123885701 TTTTTTTTTTGGTAGATACAGGG - Intergenic
979765241 4:124457146-124457168 TTTTTGTTTTGGTATAGAAATGG - Intergenic
979858328 4:125662479-125662501 TTTTGTTTTTTGGGGAAAAATGG - Intergenic
980228984 4:130023888-130023910 TTTTTGGATGGGTGGATAAATGG - Intergenic
980707417 4:136517949-136517971 TTTTTTTTTTGAGTGACAAAAGG + Intergenic
980774916 4:137425269-137425291 ATGTTGGTTTAGGGGATAAAGGG - Intergenic
981012785 4:139942799-139942821 ATTTAGCTTTGGGGAATAAAAGG - Intronic
981732323 4:147912660-147912682 TTTTTTTTTTTGGGGAGACAGGG + Intronic
982464342 4:155711847-155711869 TTTTCCTTTTGGGGAACAAATGG - Intronic
982466701 4:155741306-155741328 TTTTTGGGTTGCTGGATAAATGG + Intergenic
982569928 4:157035928-157035950 ATTTTGATATGGGGAATAAAAGG + Intergenic
982736184 4:159009317-159009339 TTTCTGTTTTAGGAGATATAAGG - Intronic
983075642 4:163322990-163323012 TTTCTGCTTTTGGGGACAAATGG - Intergenic
983198911 4:164839458-164839480 TTTTTGTTTTGGTGGAGATGGGG + Intergenic
983481680 4:168282041-168282063 TTTTTATTATGGGTGACAAAAGG - Intronic
983521418 4:168712805-168712827 TTTTTGATTTGGGGCAGGAAGGG + Intronic
983917501 4:173308218-173308240 TTTTAGTTGTGGGGGAATAAAGG + Intronic
984101161 4:175488148-175488170 TTTGTATTTTGGGGGATCAGCGG - Intergenic
984447383 4:179853974-179853996 TTGTTTCTTTGGGGGATAAAGGG - Intergenic
984594520 4:181652788-181652810 TGTTTGTTTTGGGGGTGGAAAGG - Intergenic
984957499 4:185060034-185060056 TTTTAGTTTTGGTGGATACAGGG + Intergenic
984963370 4:185119749-185119771 TTTTTTTTTTGGTGGAGACAGGG + Intergenic
985133711 4:186764691-186764713 TTTTTTTTTTGGTAGATACAGGG + Intergenic
985333966 4:188871818-188871840 TTTTTGTTTTGGGTTATGACTGG + Intergenic
986475453 5:8125895-8125917 TTTTTATTTTGGGGGGTACATGG - Intergenic
986662950 5:10075111-10075133 TTTTTCTTTTGGGCCAAAAAAGG - Intergenic
986785567 5:11111232-11111254 ATTTATTTGTGGGGGATAAAAGG - Intronic
987000447 5:13654736-13654758 GGTTTGATTTGGGGGATAAAAGG + Intergenic
987723580 5:21668489-21668511 TTTTTGTTGTGGTGTTTAAAAGG - Intergenic
987962352 5:24826715-24826737 TTTTGAGTTTGGGGGAGAAAAGG + Intergenic
988157451 5:27473403-27473425 ATTTTGTTTTGCTGGAAAAAGGG + Intergenic
988324169 5:29740149-29740171 TTGTTGTTTTGGGGGTTGAGGGG - Intergenic
989039762 5:37215753-37215775 TTTTTTTTTTTGAAGATAAACGG + Intronic
989245974 5:39255169-39255191 TATTTCATTTGGTGGATAAATGG + Intronic
989829980 5:45904454-45904476 TTTTGGTTTGGGTAGATAAATGG + Intergenic
990085594 5:51972288-51972310 TTTTAATTTTGGGGGGTATATGG + Intergenic
990413844 5:55567093-55567115 GTTTTGTTATGTGGGAAAAAAGG + Intergenic
990462365 5:56041193-56041215 TTTTTTTTTTGGTGGAGACAGGG + Intergenic
990912942 5:60871805-60871827 TTTTTCTTTTGGGAGACACAAGG + Intergenic
991534219 5:67648841-67648863 CTTTTCTTCTGGGGGGTAAAGGG + Intergenic
992040746 5:72828338-72828360 ATTTAGTTGTGGGGGATGAACGG + Intronic
992238541 5:74738823-74738845 TTTTAGTTTTGAGGAATTAATGG - Intronic
992582902 5:78200330-78200352 TTATGGTTTTTGAGGATAAAAGG + Intronic
993497146 5:88620264-88620286 TTTTTTTTTTGTGGGATCAATGG + Intergenic
993838190 5:92841542-92841564 CTATTGTTTTGGAAGATAAAGGG - Intergenic
994174498 5:96696674-96696696 TTTTTTTTTTAGGAGAGAAAGGG - Intronic
994180295 5:96756754-96756776 TTTTTGTGTAGGTGGATAAATGG + Intronic
994742636 5:103640750-103640772 TTTTTTTTTTGGAGGATTGAGGG + Intergenic
995576004 5:113535082-113535104 TTTATATTTTGTGGGAAAAAAGG + Intronic
996026558 5:118652912-118652934 CTTTTGTGATGGGGGAAAAATGG + Intergenic
996085617 5:119301893-119301915 TTTTTGTATTGGGGAAGATATGG + Intronic
996154645 5:120083309-120083331 TTTTTTTTTTTTTGGATAAAAGG + Intergenic
996365726 5:122698922-122698944 TTTTTGTTATACGGGAAAAAGGG - Intergenic
997153171 5:131521780-131521802 TTTTTATTTGGGAGGATAGAAGG - Intronic
997221153 5:132165951-132165973 TTTTTGTTTTAGTAGAGAAAGGG - Intergenic
998188495 5:140001687-140001709 TTTTTTTTTTGGTGGAGATAGGG - Intronic
998228337 5:140343722-140343744 TTTTCCTGATGGGGGATAAAAGG - Intronic
998338560 5:141395933-141395955 TTTTTTGTTTGGGGGAGCAATGG - Intronic
998506533 5:142676887-142676909 TTTTTGTTTTGAAGTAAAAATGG - Intronic
998938116 5:147252138-147252160 TTTTTGTTTTTGGTGAGACAGGG - Intronic
999409256 5:151335994-151336016 TTTTTTTTTTTGTGGATACAGGG - Intronic
999795235 5:154982659-154982681 TTTTTTTTTTGGTAGATAAGGGG - Intergenic
1000257897 5:159558360-159558382 TTTTTGTTTGAGGGCATAAGTGG - Intergenic
1000422220 5:161051374-161051396 TTTTTGTTTTGCAGGCTACAAGG + Intergenic
1000767159 5:165306369-165306391 TTTTTCATTTGGGTTATAAATGG + Intergenic
1001642622 5:173255661-173255683 TTTTTGTTTTGGTAGAGATAGGG + Intergenic
1003206212 6:4014700-4014722 TTTTTTTTTGGAGGGATAACAGG - Intergenic
1003454392 6:6268284-6268306 CTTTTGTTATAGGGAATAAAGGG - Intronic
1003729367 6:8804006-8804028 TGTATGTGTTGGGGGAGAAATGG - Intergenic
1003779197 6:9404200-9404222 TTTTAGTTGTGGGAGATGAAAGG + Intergenic
1004361490 6:14975162-14975184 TTTTTTTTTTTGGTGATAAATGG - Intergenic
1004438232 6:15618513-15618535 TTTTAGTTTTAGGGGGTAAGGGG - Intronic
1004491967 6:16126171-16126193 TTTTTGTTTTGTTTGAGAAAGGG + Intergenic
1004965167 6:20841005-20841027 TTTTTGTTTTTGTGGAGACAAGG + Intronic
1004965193 6:20841329-20841351 TTTTTTTAATGGGGGAAAAAAGG - Intronic
1005586271 6:27279491-27279513 TTTTTTTTTTGAGGTATAGAAGG - Intergenic
1006049951 6:31334602-31334624 TTTTTATTTTGGGAGCAAAAGGG - Intronic
1006227684 6:32554110-32554132 TATTTTTTCTGGGGGAAAAATGG + Intronic
1006460622 6:34155530-34155552 TTTTTGTTTTGGGACAGACAGGG + Intronic
1007128041 6:39443899-39443921 TTCATGTTTTGGGGAAAAAAAGG + Intronic
1007872188 6:45053219-45053241 TTTTTTTTTTGTGGTATAGATGG + Intronic
1007954593 6:45904744-45904766 CTTTTTTTTGGGGGGATACAAGG + Intronic
1008108311 6:47464813-47464835 TTTTAATTTTGGAGGAGAAAAGG + Intergenic
1008142389 6:47846806-47846828 TTTTTGTCTTGTGGGAAAGAAGG - Intergenic
1008794381 6:55283896-55283918 TTTTTGCTTTGAGTCATAAAAGG - Intergenic
1008950777 6:57156611-57156633 TGTTTATTTTGGGGGATGGAGGG - Intronic
1009915541 6:69990905-69990927 TTTTAGGTTTGGGGGGTACATGG + Intronic
1010205273 6:73316862-73316884 TTTTTTTTTTGGGGGGGATAGGG - Intergenic
1010211545 6:73366329-73366351 ATTTTGTTATTGGGGAAAAAGGG - Intergenic
1010233909 6:73559152-73559174 TTTTTGTTTAGGGAGAACAAAGG - Intergenic
1010419716 6:75658963-75658985 TTTTTTTTTTTGGGGAGACAAGG - Intronic
1011508318 6:88072335-88072357 TATTTGTTTTGGGGGAGGGAGGG + Intergenic
1011571661 6:88744019-88744041 TTATTTCTTTGGGGGAAAAAAGG - Intronic
1011603671 6:89081593-89081615 TTCTTGCTTTGGGGGAAGAAGGG + Intronic
1012569713 6:100708669-100708691 ATTGTGTTTTGGGGGATGGAGGG - Intronic
1013042831 6:106453595-106453617 TTTTTGTTTTATGTTATAAAAGG - Intergenic
1013164472 6:107577388-107577410 TGATTGTTTTGGGGGATGAGGGG - Intronic
1013370388 6:109465469-109465491 TTTTTGTTTTCTAGGACAAAGGG - Exonic
1013458632 6:110355722-110355744 TGTTTTGTTTGGGGGATAGATGG - Intronic
1013760460 6:113511654-113511676 TTTTTTTTTTGGAGGAGGAAAGG - Intergenic
1013954733 6:115827873-115827895 GTTGTGTTTTGGGGAAAAAAAGG + Intergenic
1014272706 6:119350447-119350469 TTTGTTTTTTGGGGGAAGAAAGG - Intergenic
1014672285 6:124320500-124320522 AATATGTATTGGGGGATAAAGGG - Intronic
1014759484 6:125340772-125340794 TTTCTGTTTAGGGGAATAGAAGG - Intergenic
1014893157 6:126867698-126867720 TTTTTCTTTAGGGGAATAAAAGG + Intergenic
1014895419 6:126894385-126894407 TTTTTTTTTTGGGGGATTGCAGG - Intergenic
1014946397 6:127503677-127503699 TGTTGTTTCTGGGGGATAAATGG + Intronic
1015072095 6:129106849-129106871 TTTTTTTTTTGGAGGAGTAAGGG - Intronic
1015442171 6:133261273-133261295 TCTTTGTTTTGGGGGTTTTAAGG + Intronic
1015734523 6:136384498-136384520 TTTTTTTTTTTGGGGAGACAGGG + Intronic
1015843527 6:137496165-137496187 TTTCTGTAATGGGGGAAAAATGG + Intergenic
1015855266 6:137617720-137617742 TTTTTGTTTTGGTGGAGACAGGG + Intergenic
1016287274 6:142487343-142487365 TTTTGATTTGGGGGGAAAAAAGG - Intergenic
1016505365 6:144772981-144773003 TTTTTTTTTTGGTGGGTGAAGGG + Intronic
1016561025 6:145395348-145395370 TTCTTGTTTTGGGACAAAAAGGG - Intergenic
1016865524 6:148761991-148762013 ATTTTGTTTTGGCAGATAACAGG + Intronic
1017213091 6:151878866-151878888 GATTTATTTTGAGGGATAAAGGG + Intronic
1017857190 6:158360084-158360106 TTTTTTTTTGGAGGCATAAAAGG - Intronic
1018226923 6:161637701-161637723 TTTTTTTTTTTAAGGATAAAAGG - Intronic
1018445533 6:163854809-163854831 TTTTTTTTTTGGGAGAAAAGAGG - Intergenic
1018465287 6:164038351-164038373 TTTATTTTTGGGGGGATAAATGG + Intergenic
1020360343 7:7320882-7320904 TTTCTGTTTTGTGGGATGACAGG - Intergenic
1020748862 7:12113221-12113243 TTTTTCTTTTGGGTGATCTACGG - Intergenic
1021093540 7:16510166-16510188 TCTTGGTTTTGGGGGATGAGTGG - Intronic
1021107500 7:16654709-16654731 TTTTTTTTTTAGTGGATACACGG + Intronic
1021712765 7:23432644-23432666 TTTTTTTTTTGGTGGAGAGAGGG + Intronic
1022262963 7:28724433-28724455 TCTTTGTTTTGGTGAATGAAAGG + Intronic
1022475826 7:30708905-30708927 TTTTTTTTTTGGTAGATAAGGGG + Intronic
1023054668 7:36282084-36282106 TTTATGTTTGGGGGTGTAAATGG + Intronic
1023567553 7:41538571-41538593 TTTTTTTTTTGGGAGAAACAGGG - Intergenic
1024037012 7:45515482-45515504 TTTTGGATTTGGAGGACAAATGG + Intergenic
1024190010 7:46996487-46996509 TTTCTTGTTTGGGGGCTAAAAGG + Intergenic
1024310156 7:47961761-47961783 TTTTTTTCTTGGGGGAGACAGGG - Intronic
1025203502 7:56977361-56977383 AATTTGTTTTGGGGGATAATGGG - Intergenic
1025668441 7:63599567-63599589 AATTTGTTTTGGGGGATAATGGG + Intergenic
1025963504 7:66246199-66246221 TTTTTTTTTTGGTGGAGACAGGG + Intronic
1026060362 7:67020205-67020227 TTTTTGTTTTTGTGGAAACAGGG - Intronic
1026072546 7:67134933-67134955 TTTTTTTTTTGGTAGAGAAAGGG - Intronic
1026704348 7:72677318-72677340 TTTTTTTTTTGGTAGAGAAAGGG + Intronic
1026729959 7:72903107-72903129 TTTTTCTTTTTGGGGGGAAAAGG - Intronic
1027494648 7:78872089-78872111 TGTTTGTTTTGGAGGAAAGAAGG - Intronic
1027658693 7:80962697-80962719 TTTTTTTTTTTTGGGAAAAATGG + Intergenic
1027685476 7:81274644-81274666 TTTTTGTTTTTGTTTATAAAGGG + Intergenic
1028336750 7:89667564-89667586 TTTTTGTGTTGGCAGATAGATGG - Intergenic
1028711499 7:93914391-93914413 TTTTTGTTTTGGTAGAGACAGGG - Intergenic
1028813114 7:95111738-95111760 CTTTTGTTTTGGTGGATAATTGG + Intronic
1028897493 7:96058814-96058836 TTTTTTTTTTGGTGGAGACAGGG + Intronic
1028974967 7:96902599-96902621 TTTTAGATTTGGGGGTTACATGG + Intergenic
1029244715 7:99190660-99190682 TTTTTTTTTGGGGGGAGACAGGG + Intronic
1029838909 7:103342171-103342193 TTTTTGTTTTGTCAGATAACTGG - Intronic
1029912672 7:104171512-104171534 TTTTTTATTTGGGGGATGAGAGG + Intronic
1030197361 7:106865630-106865652 TTTTTGTTTTGGGAGGAAAAGGG + Exonic
1030209146 7:106979490-106979512 TTTCTGATTTGGAGCATAAAAGG + Intergenic
1030440107 7:109578914-109578936 TTTTTTTTTTGGGGGGGACAAGG - Intergenic
1031005452 7:116465491-116465513 TTATTCTTTTTGTGGATAAAAGG + Intronic
1031620345 7:123927510-123927532 TTTTGGTTTTGGGAGAAAGATGG + Intronic
1031683808 7:124708500-124708522 TTTTTTTTTTTGGCTATAAATGG + Intergenic
1031727303 7:125257075-125257097 TTCTTATTTTGAGGGGTAAAAGG - Intergenic
1031745240 7:125487809-125487831 TTTTTGTTTTTGGAGAGAATAGG - Intergenic
1031974972 7:128087870-128087892 TTTCTGTTTCTGGGGATAGAGGG - Intronic
1032241355 7:130161782-130161804 ATTTTGGTTTGGGGCAGAAAAGG + Intergenic
1032791416 7:135245848-135245870 TATGTGTTTTGGGGGAGAGAGGG - Intronic
1032875346 7:136032574-136032596 TTTTTGGTTAGAGGAATAAAGGG - Intergenic
1033163834 7:139020981-139021003 TTTTTTTTTTTGGGGAGACAGGG - Intergenic
1033417781 7:141179396-141179418 TTTTTCTTTTGAGGGACAGAAGG + Intronic
1033800692 7:144898488-144898510 TTTGTGATGAGGGGGATAAAAGG - Intergenic
1034336678 7:150328349-150328371 TTTTTGTATTGAGAGAAAAATGG - Intronic
1035166902 7:156996076-156996098 TTTTTCTTTTGTTAGATAAAGGG + Intronic
1036024769 8:4893858-4893880 TTTCTGTTTTTGGGGAAAAAAGG - Intronic
1036307518 8:7612659-7612681 TTTTTTTTTTGGGAGATATGAGG - Intergenic
1036419622 8:8583623-8583645 TCTGGGTTTTCGGGGATAAAAGG + Intergenic
1036781036 8:11647740-11647762 TTGTTGTATTTGGGGTTAAACGG + Intergenic
1037322060 8:17653384-17653406 TTTTTTTTGTGGGGGATACTGGG + Intronic
1037323009 8:17661632-17661654 TTTTTTTTTTGGTGAATAGAGGG - Intronic
1037536443 8:19828727-19828749 TTTTTTTTTTGGTGGAGACAAGG + Intronic
1037716275 8:21403593-21403615 ATAATGTTTTGGGGGTTAAAAGG + Intergenic
1037909570 8:22735860-22735882 TTTTTGTTTCAGGTAATAAAAGG + Intronic
1038492017 8:27978201-27978223 TTTTTTTTTTAGGAGAGAAAAGG + Intronic
1038606940 8:29016424-29016446 ATAGTGTATTGGGGGATAAAGGG + Intronic
1038980126 8:32750698-32750720 TTTTTTTTTTGAGGAAGAAATGG - Intronic
1039002765 8:32999751-32999773 TTTTTGTTCTTGTGGATAAGAGG - Intergenic
1039814487 8:41080959-41080981 TTTTTGTTTTTGAGGAGATAGGG - Intergenic
1040509235 8:48078898-48078920 TTTTTTTTTTTTGGCATAAATGG - Intergenic
1040893217 8:52338915-52338937 TTTTTGTGCTGGGGGAGACAGGG + Intronic
1041056327 8:53990229-53990251 TTTTTTTTTTGGTAGAGAAAGGG + Intronic
1041056686 8:53993143-53993165 TTTTTTTTTTGGTAGAGAAAGGG + Intronic
1041752461 8:61275788-61275810 TTGTTCTTTTGAGGGATGAATGG - Intronic
1042075016 8:64983914-64983936 TTTTTCCTTGGGGGGAAAAAGGG - Intergenic
1042545540 8:69947862-69947884 GTTTTGTTTTGGGGGGGAAATGG + Intergenic
1042814887 8:72867473-72867495 TTTTGTTTTTGGTGGAGAAAGGG - Intronic
1043055020 8:75426656-75426678 TTTATTTATTGGAGGATAAAAGG + Intronic
1043172406 8:76981454-76981476 TGTTTGTTTTTGGTGAGAAAGGG - Exonic
1043202129 8:77383439-77383461 TTTTTTTTTTTGGAGAGAAAAGG - Intergenic
1043530087 8:81140222-81140244 TTTTTGTTTTGTGCACTAAAAGG - Intergenic
1043741292 8:83815145-83815167 TTTTTGTCTTGGGGCATATTTGG + Intergenic
1043866960 8:85385781-85385803 TTTTTATTTTTGGTGACAAATGG - Intronic
1043876704 8:85493753-85493775 TTTCTATTTTGGGGGCTATATGG - Intergenic
1044105531 8:88201132-88201154 TTTTTTTTTTGGGGGGGGAAAGG - Intronic
1044211721 8:89558513-89558535 TTTTTTTTTTGAGAGGTAAAGGG + Intergenic
1044256544 8:90069979-90070001 TTTTTTTTTTGGAAGAAAAAAGG + Intronic
1044288903 8:90444433-90444455 TTTTTGTTTAGTGAAATAAATGG - Intergenic
1044746751 8:95378256-95378278 TTTTTTTTTTGGTGGAGAAGGGG + Intergenic
1044866235 8:96573919-96573941 TTTTAGTTCTGTGTGATAAAGGG - Intronic
1044968818 8:97599925-97599947 TTTTTTTTTTGGTGGAGAAGGGG - Intergenic
1045120585 8:99029597-99029619 TTTTTTTTTTGGTGGAGACAGGG - Intronic
1045235024 8:100344067-100344089 TTTTTGTTTTAGTGGGAAAAGGG + Intronic
1045380583 8:101620420-101620442 TTATTATTTTGTGGGTTAAATGG + Intronic
1045440724 8:102207252-102207274 ATATTTTTTTGGGGGAAAAAGGG - Exonic
1045634835 8:104172721-104172743 ATTTTGTGTTGGAGCATAAATGG + Intronic
1045865115 8:106856442-106856464 TTTTTGGTTTGTGGGAGAAAAGG - Intergenic
1046239876 8:111476526-111476548 TTGTTGTTTTGGCGGATAATAGG - Intergenic
1046473090 8:114704624-114704646 TTTTTGTTTTGGTAGAGACAGGG - Intergenic
1046579868 8:116078706-116078728 TTTTTCTTGTGGGAGATGAAGGG + Intergenic
1046895272 8:119464615-119464637 TTGTTGTTTTGGAGGAAAGAAGG - Intergenic
1046974242 8:120255789-120255811 TTTTTTCTTTTGGGGATAATTGG + Intronic
1048078160 8:131095770-131095792 CTTCTGTTTTGGGGGATTGAGGG + Intergenic
1048239018 8:132722197-132722219 TTTTTTTTTTGGTGGGTACAAGG - Intronic
1048378899 8:133846583-133846605 CTTTAATTTTGGGGGAAAAAAGG + Intergenic
1048514126 8:135090302-135090324 TTTTTGTTAAAGGGGAAAAATGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049103055 8:140593101-140593123 TGTATGTTTTGGGTGAAAAAAGG - Intronic
1049127401 8:140804411-140804433 TTTTTCTTTTGGTAGAGAAAGGG - Intronic
1049926095 9:408922-408944 TTACTCTTTTGGGGGAGAAAGGG - Intronic
1049995873 9:1033057-1033079 TTTTTGTTTTTGTGGACACAGGG - Intergenic
1050176516 9:2874681-2874703 TTTTTTTTTTCAGGGAAAAAAGG + Intergenic
1050362982 9:4848192-4848214 TTTTTCTTTTTGGGTAGAAAAGG + Intronic
1051147244 9:14040564-14040586 TTTTTGTTTTGTTTTATAAATGG + Intergenic
1051391006 9:16563444-16563466 TTTTTTTTTTGGTAGATACAGGG - Intronic
1051461565 9:17323355-17323377 GATTTGTTTTGTGGCATAAATGG + Intronic
1051769243 9:20558303-20558325 TTTTTGTTTTGGTAGAGACAGGG + Intronic
1052715554 9:32112152-32112174 TATATCTTTTGGGGCATAAAGGG - Intergenic
1052955680 9:34251626-34251648 ATTTTCTTTTGGGGGTTAGAAGG + Exonic
1053705838 9:40751980-40752002 CTTTTGGTTTGTGGGGTAAAGGG - Intergenic
1054415915 9:64875584-64875606 CTTTTGGTTTGTGGGGTAAAGGG - Intergenic
1054712948 9:68529770-68529792 TTTTGCTTTTGGGGGATAGAGGG + Exonic
1054917852 9:70512150-70512172 TTTTTTTTTTGGTGGAGACAGGG + Intergenic
1055132077 9:72787005-72787027 TTTTTTTTTTGGAGGCCAAAAGG - Intronic
1055321073 9:75084040-75084062 TTTTTGGTTTAGGGGATGGAGGG + Intronic
1055988951 9:82084391-82084413 TTATTGTTTTGTGGAATAACAGG + Intergenic
1056139814 9:83664910-83664932 TTTTTTTTTGGTGGGATACAGGG - Intronic
1056704140 9:88937440-88937462 TTTATGTTTTGGTGGAGACAGGG + Intergenic
1057828468 9:98389298-98389320 TTGTTGCCTTGGGGGATAAATGG - Intronic
1058734500 9:107881956-107881978 GTTTTGTCTTGGGTGAGAAAAGG - Intergenic
1058887670 9:109334142-109334164 TTTTTGTTTTTGGGAAAAAAAGG - Intergenic
1059289920 9:113213565-113213587 TTTTTGGTTCGGGGGAGACAGGG - Intronic
1059637636 9:116186477-116186499 TTTCTTTCTTTGGGGATAAATGG + Intronic
1059808670 9:117831895-117831917 TTTATCTTTTGAAGGATAAATGG - Intergenic
1060320064 9:122550562-122550584 TTTTTTTTTTGAGGAATACAAGG + Intergenic
1060573370 9:124664999-124665021 TTTTTTTTTTTGGAGATACAAGG - Intronic
1186341563 X:8651216-8651238 TTTGTGGTTTGGGAGGTAAAGGG - Intronic
1186578191 X:10788956-10788978 TTTTTGTTTTGGTAGAGACAAGG - Intronic
1186984491 X:14997190-14997212 TTTTTGTTCTTGGGGATACCTGG - Intergenic
1187659482 X:21524671-21524693 TTTTTGTTTGGGGAGAAGAAGGG + Intronic
1187741374 X:22359539-22359561 GTTTTGTTTTGGGTTTTAAAGGG - Intergenic
1188052094 X:25500131-25500153 TTTTTTTTTTGAGAGTTAAATGG + Intergenic
1188186534 X:27123264-27123286 TAATTTTTTTGGGGGAAAAAGGG + Intergenic
1188530820 X:31138926-31138948 TTTTTGTTTTTGGTGATGAGGGG - Intronic
1188990527 X:36813688-36813710 TTTACATTTTGGGGGAGAAAGGG - Intergenic
1189774068 X:44454597-44454619 TATTTGTTTTGGTGGAGGAAGGG - Intergenic
1191953282 X:66617543-66617565 TTTCTGTTTTGTGGGCAAAAAGG - Intronic
1192098943 X:68243256-68243278 TTTCTGCTTGGGGTGATAAAAGG + Intronic
1192152161 X:68719121-68719143 TTTTTCTTTGGGGAGAAAAAAGG + Intronic
1192431614 X:71116241-71116263 TTTTTTTTTTGGTGGAGACAGGG - Intergenic
1192523936 X:71825244-71825266 TTTTTTTTTTGGTGGATATGCGG + Intergenic
1192635809 X:72815881-72815903 TATTTTTTTGGGGGGAGAAATGG + Intronic
1192645905 X:72904922-72904944 TATTTTTTTGGGGGGAGAAATGG - Intronic
1192815234 X:74583724-74583746 TTTGTTTTTTGGAGGATTAATGG - Intergenic
1193509994 X:82387994-82388016 TATTTTTATTGTGGGATAAATGG + Intergenic
1194109484 X:89815442-89815464 TTTTGAATTTGAGGGATAAAAGG - Intergenic
1194555196 X:95349753-95349775 TTTTTTTTTTGGTGGAGACAGGG + Intergenic
1195370974 X:104172227-104172249 TTTTTTTTTTGGAAGAGAAAGGG - Intronic
1196170418 X:112581538-112581560 AGTTTGTGTGGGGGGATAAATGG + Intergenic
1197795419 X:130292830-130292852 GTTTTGTTTTGGGAGTTAAAGGG - Intergenic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1198978376 X:142363392-142363414 TTTTTTTTTTGTCGGATAAAGGG + Intergenic
1199162177 X:144626706-144626728 TTAATGTTTAGTGGGATAAAAGG + Intergenic
1199208007 X:145172179-145172201 TTTTTATTTGGGGGGGTTAAAGG - Intergenic
1199470490 X:148190583-148190605 TTTTTTTTTTGGTGGAGACAGGG - Intergenic
1200156413 X:153978585-153978607 TTTTTTTTTTGGGGGGGAGAGGG + Intronic
1200462146 Y:3470184-3470206 TTTTGAATTTGAGGGATAAAAGG - Intergenic
1201408556 Y:13673869-13673891 TATTTCTTTTGGGAAATAAAGGG + Intergenic
1201609497 Y:15824872-15824894 TTTTTGTTTTTGTAGATACAGGG - Intergenic
1201699213 Y:16861480-16861502 TTTTTTTTCTGGGGAATACAAGG - Intergenic
1202281677 Y:23197763-23197785 TTTTCGTTTTTGGAAATAAAAGG - Intronic
1202284214 Y:23220756-23220778 TTTTCGTTTTTGGAAATAAAAGG + Intronic
1202433349 Y:24812148-24812170 TTTTCGTTTTTGGAAATAAAAGG - Intronic
1202435890 Y:24835142-24835164 TTTTCGTTTTTGGAAATAAAAGG + Intronic