ID: 1062865637

View in Genome Browser
Species Human (GRCh38)
Location 10:850665-850687
Sequence ATATTCTTCTCAAGGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062865634_1062865637 -2 Left 1062865634 10:850644-850666 CCCATAGCAACAGCAAAACACAT No data
Right 1062865637 10:850665-850687 ATATTCTTCTCAAGGACAAATGG No data
1062865633_1062865637 -1 Left 1062865633 10:850643-850665 CCCCATAGCAACAGCAAAACACA 0: 1
1: 1
2: 3
3: 37
4: 532
Right 1062865637 10:850665-850687 ATATTCTTCTCAAGGACAAATGG No data
1062865632_1062865637 23 Left 1062865632 10:850619-850641 CCTCATTAACACTGACAAAATAT 0: 1
1: 0
2: 3
3: 28
4: 345
Right 1062865637 10:850665-850687 ATATTCTTCTCAAGGACAAATGG No data
1062865635_1062865637 -3 Left 1062865635 10:850645-850667 CCATAGCAACAGCAAAACACATA 0: 1
1: 0
2: 1
3: 25
4: 284
Right 1062865637 10:850665-850687 ATATTCTTCTCAAGGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062865637 Original CRISPR ATATTCTTCTCAAGGACAAA TGG Intronic
No off target data available for this crispr