ID: 1062866921

View in Genome Browser
Species Human (GRCh38)
Location 10:863560-863582
Sequence CCCTGGTTAGGGAGGTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062866921_1062866929 7 Left 1062866921 10:863560-863582 CCATGGCACCTCCCTAACCAGGG 0: 1
1: 0
2: 1
3: 25
4: 197
Right 1062866929 10:863590-863612 TCTTCTCTGCATCCACATAAGGG 0: 1
1: 0
2: 3
3: 20
4: 201
1062866921_1062866928 6 Left 1062866921 10:863560-863582 CCATGGCACCTCCCTAACCAGGG 0: 1
1: 0
2: 1
3: 25
4: 197
Right 1062866928 10:863589-863611 ATCTTCTCTGCATCCACATAAGG 0: 1
1: 0
2: 1
3: 23
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062866921 Original CRISPR CCCTGGTTAGGGAGGTGCCA TGG (reversed) Intronic
900401643 1:2475221-2475243 CCCAGGACAGGGAGGTGCCAGGG - Intronic
900411291 1:2513840-2513862 CCCTGGCTATTGTGGTGCCAGGG + Intronic
900530959 1:3152981-3153003 CCCTAGTCAGGGAGGTGCCCAGG + Intronic
900658153 1:3770321-3770343 CCCTGGTCAGGAAGGAGCCCAGG - Intronic
903357954 1:22759657-22759679 ACCTGGTGAGGGAGGTGGCTGGG - Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904482295 1:30801661-30801683 CCTGGGGTAGGGAGGTGCCCAGG - Intergenic
906533630 1:46539002-46539024 CTCTGGTTAGGGAGGCCTCATGG + Intergenic
907158090 1:52352784-52352806 CCCTGCTGAGGGTGGTGTCAGGG - Exonic
910639785 1:89447018-89447040 CCTTGGTTATTGAGGTCCCAAGG + Intergenic
914716187 1:150257065-150257087 CCCTGGAGAGGGAGGTGGCTGGG + Intergenic
915944083 1:160137046-160137068 GCCTGGGTGGGTAGGTGCCATGG - Intronic
916046024 1:161000465-161000487 CCCTGGTTAGGTGGCAGCCAGGG - Intronic
917649548 1:177063311-177063333 AGGTGGTTAGGGAGGGGCCAAGG - Intronic
921189391 1:212696367-212696389 TCCTGGATAGGGCAGTGCCAGGG + Intronic
924945607 1:248844747-248844769 ACATGGTTTGAGAGGTGCCATGG + Intronic
1062866921 10:863560-863582 CCCTGGTTAGGGAGGTGCCATGG - Intronic
1062968616 10:1629241-1629263 CCCTGGTGAGTGATGAGCCAGGG + Intronic
1063002975 10:1942051-1942073 CCCTGCTTAGGGAGGACCCTGGG - Intergenic
1063450725 10:6148282-6148304 CTGTGGTTAGGTTGGTGCCATGG + Intronic
1065001371 10:21340690-21340712 GCCTGGGGAGGGTGGTGCCACGG - Intergenic
1067023804 10:42826571-42826593 CCCTGGGGAGGCAGGTGCCTGGG + Intronic
1067458526 10:46440644-46440666 CCATGGTGAGTGAGGTGCCCAGG + Intergenic
1067734244 10:48837190-48837212 AGCTGGTTAGGAAGGGGCCATGG + Intronic
1070566240 10:77605665-77605687 CCCAGTTGAGGGAGGTGACAGGG + Intronic
1074184161 10:111086725-111086747 GCCTGGTGATGCAGGTGCCAGGG + Intergenic
1074772609 10:116743145-116743167 CCCTGGGTCCGGAGTTGCCATGG - Intergenic
1075636915 10:124035649-124035671 TCCTGTTTAGGGTGGAGCCAAGG - Intronic
1078654126 11:13222403-13222425 GCCTGGGTAGGCAGTTGCCAGGG - Intergenic
1079209735 11:18450283-18450305 CCCAGGATAGGGCAGTGCCATGG + Intronic
1079210695 11:18458161-18458183 CCCAGGATAGGGCAGTGCCATGG + Intronic
1080685549 11:34512117-34512139 CCCTTCTTAGGGAGGTCCAAGGG - Intronic
1081708911 11:45204634-45204656 CCCTGGTTGGGAAGGAGCCCAGG + Intronic
1082760903 11:57126088-57126110 CCATGGCTAGGGAGGTGGCAGGG - Intergenic
1083156701 11:60827857-60827879 CCCTGGTTTTGCAGGTGCCCTGG + Intergenic
1083270901 11:61572067-61572089 GCCTGGTTGGGGAGGTGCGAAGG - Intronic
1084729247 11:71062629-71062651 CCCTGCTCAGGGAGGAGCCTGGG + Intronic
1085017240 11:73182861-73182883 CCCAGGATAGGGGGCTGCCATGG - Intergenic
1086559670 11:88153539-88153561 CCCCATTTAGGGAGCTGCCAGGG - Intronic
1091312464 11:134584456-134584478 TCCTGGCCAGGGAGCTGCCAGGG + Intergenic
1092148645 12:6232138-6232160 CCCTGGGTAGGGGGGTGCCTAGG + Intronic
1094499143 12:31007423-31007445 CCCAGGTCAGTGAGGAGCCAAGG - Intergenic
1095941486 12:47730059-47730081 CCCTTGTAGGGGTGGTGCCAAGG - Intergenic
1097077912 12:56408829-56408851 ACCTGGATAGGGAGGTGCGGAGG + Intergenic
1097269450 12:57765322-57765344 CCCTGGTTCGGGACGTGGCGGGG - Exonic
1102546927 12:113664068-113664090 CCCTGGGTAGGGAGAGACCAGGG + Intergenic
1102963843 12:117111618-117111640 CCCTGGATGGGGAGGTGCCGGGG - Intergenic
1103085618 12:118060659-118060681 CCCTGGGTACCCAGGTGCCAGGG - Intronic
1103984763 12:124759954-124759976 CCCTGGCCCGCGAGGTGCCAGGG - Intergenic
1104799435 12:131543786-131543808 GCCTGGCTGGGGAGGTGCCAGGG + Intergenic
1105255897 13:18743962-18743984 CACCGGTCATGGAGGTGCCATGG + Intergenic
1106184718 13:27399274-27399296 ACATGGGTAGGGAGGTGCCGAGG + Intergenic
1107563671 13:41580574-41580596 CCTTGGATGGTGAGGTGCCAAGG + Intronic
1114524451 14:23359424-23359446 GCCTGGTTATGGAGGCCCCAAGG - Exonic
1118362705 14:65069592-65069614 CCCTTGATAGGGCGGTTCCAGGG - Intronic
1118903847 14:70008899-70008921 CCCTGGCTGGGAAGGTGCCATGG - Intronic
1122976605 14:105173429-105173451 CCCTGCTGCGGGAGGGGCCACGG - Intronic
1123424952 15:20163608-20163630 CCCTGGGGAGGCAGGTGCCTGGG + Intergenic
1123534176 15:21170141-21170163 CCCTGGGGAGGCAGGTGCCTGGG + Intergenic
1123906245 15:24924416-24924438 CCCTGGTTAGTGAGTTTCCTGGG + Intronic
1124564228 15:30799946-30799968 CCCAGGGGAGGGAGCTGCCAAGG + Intergenic
1125508638 15:40281552-40281574 GCCTGGTCGGGGAGGCGCCAGGG - Exonic
1125524359 15:40365729-40365751 AGCTGGTGGGGGAGGTGCCAGGG + Intronic
1125932042 15:43607196-43607218 CCATGGGTAGGGAGGAGCCTTGG + Intronic
1125945140 15:43706670-43706692 CCATGGGTAGGGAGGAGCCTTGG + Intergenic
1126698437 15:51345411-51345433 TTCTTGTTAGAGAGGTGCCAAGG - Intronic
1129035755 15:72647523-72647545 CCATGTTTGGGGAGGTGACAGGG - Intergenic
1129214129 15:74089693-74089715 CCATGTTTGGGGAGGTGACAGGG + Intergenic
1129399881 15:75275676-75275698 CCATGTTTGGGGAGGTGACAGGG - Intronic
1130201842 15:81838247-81838269 CACAGTGTAGGGAGGTGCCAAGG - Intergenic
1130596794 15:85254680-85254702 CTGTGGGTAGGCAGGTGCCAAGG + Intergenic
1130866048 15:87934107-87934129 CCTTGGTTAGGGCACTGCCATGG + Intronic
1132411556 15:101582062-101582084 CCCTGATTAGAGAGGGGCAAGGG + Intergenic
1133107350 16:3521087-3521109 CGCTGGGCAGGGAGGAGCCAGGG - Intronic
1133225275 16:4337836-4337858 ACTAGGTGAGGGAGGTGCCAGGG - Exonic
1136279770 16:29201477-29201499 CCCTGGTTAGGAATGTGGTAGGG + Intergenic
1136790510 16:32965370-32965392 CTGTGGTAAGGAAGGTGCCATGG - Intergenic
1136859908 16:33692137-33692159 CCCTGGGGAGGCAGGTGCCTGGG - Intergenic
1136879304 16:33888562-33888584 CTGTGGTAAGGAAGGTGCCATGG + Intergenic
1137671076 16:50279584-50279606 CCCTGGTTGGGGCAGTGCTAAGG + Intronic
1137734879 16:50716400-50716422 CCCTGGCCAGGGAGGTGACGTGG - Intronic
1137745485 16:50817250-50817272 CCCTGGTTGGGGTGGTGCATAGG + Intergenic
1142084159 16:88167587-88167609 CCCTGGTTAGGAATGTGGTAGGG + Intergenic
1203092713 16_KI270728v1_random:1226828-1226850 CTGTGGTAAGGAAGGTGCCATGG - Intergenic
1203121413 16_KI270728v1_random:1540316-1540338 CCCTGGGGAGGCAGGTGCCTGGG - Intergenic
1143446513 17:7013160-7013182 CCCTGGAGTGGGAGGAGCCAGGG + Intronic
1144447197 17:15341818-15341840 CCTTGGTTTGGGAGGTGAAAGGG + Intergenic
1144653015 17:17018895-17018917 CCCTGTCTAGGGAGGGGCCCTGG - Intergenic
1146445150 17:32927583-32927605 CCCTGGCTAGGCAGTCGCCAGGG + Intergenic
1146820825 17:35982645-35982667 CTCTGTTTATGGAGGTGACAAGG + Intergenic
1147152776 17:38527954-38527976 CTGTGGTAAGGAAGGTGCCATGG - Intergenic
1148782727 17:50130549-50130571 GCCAGGGTAGGGAAGTGCCAGGG + Intergenic
1148800522 17:50222120-50222142 CTCTGGTCAGGGATGTGCCAAGG + Intergenic
1150160527 17:62894105-62894127 CTCAGGTTGGGGAGGGGCCAGGG + Intergenic
1152324372 17:79627134-79627156 CCCTGGACAGGGAAGGGCCAGGG - Intergenic
1154145796 18:11865315-11865337 GCCTGGTGAGGCAGGTGGCAGGG - Intronic
1157718851 18:49907975-49907997 CCCTGCTTGGGGAGGCTCCATGG + Intronic
1158743050 18:60165616-60165638 TCCTGGGTAGGGGGGTGGCAGGG - Intergenic
1159599910 18:70419192-70419214 CTCTGGTGTGGGAGGTGGCAGGG - Intergenic
1160229014 18:77032463-77032485 CCCTGCCGTGGGAGGTGCCAGGG - Intronic
1161084082 19:2326013-2326035 CACTGGTCAGGCTGGTGCCAAGG - Intronic
1161216233 19:3096181-3096203 CCCGGGTTACAGAGGTGCCTTGG + Intronic
1162894714 19:13758198-13758220 CCCGGGTGAGGGAGGAGCCTTGG - Intronic
1163319260 19:16563464-16563486 CCATGGTCAGGGAGGGGACAGGG + Intronic
1166253035 19:41584577-41584599 AGCTGGTGAGGAAGGTGCCATGG - Intronic
1166368505 19:42289255-42289277 CCCTGGTGAGGGAGGTGCCTTGG + Exonic
1166526237 19:43511809-43511831 CTCTGGTTAGGAAGGTGATATGG + Intronic
1167894622 19:52570847-52570869 CCAGCGTTGGGGAGGTGCCAGGG + Exonic
1167909400 19:52689885-52689907 CCCGCGTTGGGGAGGTGCCCGGG - Intronic
1167930098 19:52857026-52857048 CCCTCGTTGGAGAGGTGCCTGGG - Intronic
1167940412 19:52942090-52942112 CCCGCGTTGGGGAGGTGCCCGGG - Intronic
1167952280 19:53037306-53037328 CCCGCGTTAGGGAGGTGCCCAGG - Intergenic
1167955075 19:53057961-53057983 CCCGCGTTGGGGAGGTGCCCGGG - Intergenic
1167960728 19:53102826-53102848 CCCTCGTTGGGGAGGTGCCCGGG - Intronic
1167971839 19:53192775-53192797 CCCGCGTTGGGGAGGTGCCCGGG - Intronic
1167987947 19:53334222-53334244 CCCGCGTTGGGGAGGTGCCCGGG + Intronic
1167995144 19:53395716-53395738 CCCGAGTTAGGGAGGTGCCCGGG + Intronic
1167999404 19:53432531-53432553 CCCGCGTTGGGGAGGTGCCCGGG + Intronic
1168003654 19:53468301-53468323 CCCACGTTGGGGAGGTGCCCGGG + Intronic
1168107401 19:54173163-54173185 CCCAGGTAAGGGAGGGGCCAGGG + Exonic
926004816 2:9365552-9365574 CCCTGCTCAGGTAGGTGCTAAGG + Intronic
927638876 2:24834467-24834489 CCCTGGTGAGGGAGGGGCCGGGG - Exonic
929044062 2:37773550-37773572 CTCTGGGCAGGGAGGGGCCAAGG - Intergenic
930799297 2:55425940-55425962 CCCTGGGCAGGGAGGGGGCATGG + Intergenic
934458265 2:94193245-94193267 CCCTGGGGAGGCAGGTGCCTGGG - Intergenic
936927595 2:117753462-117753484 CCCTGGTCAGGCAGGAGACAGGG + Intergenic
944523963 2:200599454-200599476 CCCTGGGGAGGGAGGTGCCTGGG + Intronic
946220321 2:218220095-218220117 GCCAAGTTAGGGAGGTGCTAAGG + Intronic
946397829 2:219452089-219452111 CCCTGTTCAGGGAAATGCCATGG - Intronic
947470034 2:230392899-230392921 CCCTGGGAAGGGAGGACCCATGG - Intronic
947914356 2:233822028-233822050 CCCTACTTAGGGGGCTGCCAAGG + Intronic
948678063 2:239610726-239610748 CCCTTGCTAGTGATGTGCCAAGG + Intergenic
948858317 2:240740879-240740901 CCCTGGGGAGGCAGGTTCCAGGG - Intronic
1169673667 20:8132008-8132030 CCCTGGTTGCAGAGGTGCTAGGG - Intergenic
1170604123 20:17863274-17863296 CCCTCGATAGGGGTGTGCCAAGG - Intergenic
1171349368 20:24490968-24490990 GCCCACTTAGGGAGGTGCCATGG + Intronic
1171437307 20:25133538-25133560 CCCTGGTCTGGGAGGAGGCATGG - Intergenic
1172977643 20:38918732-38918754 CCCTGGCTGGGGAGGTGTCAGGG + Exonic
1173580323 20:44142509-44142531 CCCGGGAGAGGGAGGGGCCAGGG - Intronic
1175334588 20:58186972-58186994 CCCTGGTCAGGCAGGTGCAATGG + Intergenic
1175768031 20:61604601-61604623 CCCTGGCTTGGGAGGTGTCTCGG + Intronic
1175785735 20:61710640-61710662 CCCTGGTGAGGAAGGGGCAAGGG + Intronic
1175929298 20:62486063-62486085 CCATGGTGCTGGAGGTGCCAGGG - Intergenic
1176425714 21:6547206-6547228 CCCTGGTTTGGTGGGTGTCATGG + Intergenic
1179281525 21:39938234-39938256 CCTTGGACAGGGAGGTGCCAAGG + Intergenic
1179701205 21:43155523-43155545 CCCTGGTTTGGTGGGTGTCATGG + Intergenic
1180119345 21:45736523-45736545 CCCTGGTTAGAGAGACGGCATGG + Intronic
1181357944 22:22313182-22313204 CCCTGGGGAGGCAGGTGCCTGGG + Intergenic
1182349778 22:29692738-29692760 CCCTGGGGAGGGAGGAGCCCTGG - Intronic
1183599804 22:38833309-38833331 CCCTGGTGAGGGAGGTGGGGTGG - Intronic
1183731016 22:39618688-39618710 TCCTGGGGTGGGAGGTGCCAGGG + Intronic
1183927435 22:41216279-41216301 CCCTGCTTAGGAAGCTGCCGTGG + Intronic
1184690534 22:46115338-46115360 GCCTGGTCGGGGAGCTGCCAGGG + Intergenic
1185052889 22:48562991-48563013 CTCTGGTGTGGGAGATGCCAAGG - Intronic
1185066506 22:48635019-48635041 TCCTGGTCAGGGAGGTGCCCGGG + Intronic
1185285483 22:49997975-49997997 CCCTATTTGGGGAGGGGCCAGGG - Intronic
950114361 3:10441085-10441107 CCCAGGAAAGGGAGGTGCAAAGG - Intronic
950495911 3:13334518-13334540 CCCTGATCAGGGAGGTGCTTGGG + Intronic
950580035 3:13856006-13856028 TCCTGGGGAGGGAGGTCCCAAGG - Intronic
950703744 3:14767393-14767415 GCCAGGGTAGGGAGGTGCCCTGG + Intronic
951746258 3:25980929-25980951 CCATGGCAAGGTAGGTGCCAGGG - Intergenic
955262494 3:57407299-57407321 CCGGGGGTAGGGAGGTGGCAGGG + Intronic
956563993 3:70615127-70615149 CCCTTGTTAGGGCAGTGCCAAGG - Intergenic
960864367 3:122184569-122184591 CCCTGGTGGGGGAGGGGCCGTGG + Intronic
961552905 3:127679300-127679322 CCCAGGTAAAGGAGGTGGCATGG + Intronic
961822267 3:129581097-129581119 CCCTGGGAAGGGAGGTGCTAGGG - Intronic
962114839 3:132493219-132493241 CTCAGGTTAGGGGGGTCCCAAGG - Intronic
968521541 4:1036712-1036734 CCCTGGTGAGGCCGGGGCCAGGG + Intergenic
968978169 4:3832745-3832767 GCAGGGTTGGGGAGGTGCCAGGG + Intergenic
969630480 4:8333021-8333043 CCCTGGGTAGGGCTGGGCCATGG - Intergenic
977252125 4:94700897-94700919 TCCTGGGTAGGGAGGGGCTAGGG - Intergenic
985822198 5:2168024-2168046 CCCTGGGAAGGGAGGTGCCCAGG + Intergenic
986014901 5:3749092-3749114 CCCTGGTGAAGGAGGCACCAGGG - Intergenic
990134656 5:52630932-52630954 CACTGGTTGGGGTGGAGCCATGG + Intergenic
997472665 5:134125394-134125416 CCCTGGCAAGGGAGGTGGCCTGG - Intronic
998005774 5:138655917-138655939 CAATGGTTGGGCAGGTGCCAAGG - Intronic
998131041 5:139651145-139651167 CCTTGGAAAGGGAGGTGGCATGG - Intronic
1001044897 5:168364262-168364284 CCATGGTTAAGGAGGAGGCAGGG - Intronic
1001599508 5:172919833-172919855 CTCTGGTCAGGGGAGTGCCAGGG + Intronic
1001645492 5:173278736-173278758 TCCAGGTTAGGGAGGCGGCAGGG + Intergenic
1001852421 5:174981069-174981091 CTCTGGTCAGTGAGGTGCCCCGG - Intergenic
1001880450 5:175239344-175239366 CTGTGGTTAGGGAAGTGCCTGGG - Intergenic
1002087711 5:176786083-176786105 AGCTCCTTAGGGAGGTGCCAGGG - Intergenic
1004290594 6:14363535-14363557 CCCGGGTTGGGGAGGTGGGAAGG + Intergenic
1006056118 6:31385664-31385686 CCCTGGTGCTGGAGGTGGCAGGG - Intergenic
1016016039 6:139187158-139187180 TCCTGGGTAGGGAGGTGCAGGGG - Intergenic
1027139474 7:75646987-75647009 TCCTGGTTAGGAAAGGGCCAGGG + Intronic
1027313515 7:76970263-76970285 CTGTTGTCAGGGAGGTGCCATGG + Intergenic
1031627300 7:124005332-124005354 TCCTTCTTAGGGAGGTGCAATGG + Intergenic
1032078099 7:128845652-128845674 CCCTGGCTAGGCATGGGCCACGG + Intronic
1033627833 7:143128304-143128326 CCCTGGTGATGTAGGGGCCAAGG - Intergenic
1034269208 7:149795518-149795540 GCCTGGGGAGGGAGGGGCCAGGG - Intergenic
1034436716 7:151066082-151066104 CCATGTCTAGGGATGTGCCAGGG + Intronic
1034925622 7:155119088-155119110 ACCTGGTTAGGTAGGGGCTAAGG + Intergenic
1036204561 8:6795486-6795508 CTCTGGTGGGGGAGGTTCCAGGG - Intergenic
1039110466 8:34035933-34035955 CTCTGGTGTGTGAGGTGCCAAGG - Intergenic
1039612778 8:38932561-38932583 GCCTGGTTAGCCAGGTGTCAGGG - Intronic
1041012418 8:53558307-53558329 CCCTGGGTAGGGAGCCTCCACGG - Intergenic
1041167162 8:55101968-55101990 CCCTGGCTCGGGAGGGGCGAGGG - Intergenic
1042777449 8:72449178-72449200 CACTGGTTAAGAAGGTGCCATGG - Intergenic
1046031337 8:108786967-108786989 CCCGGATTAGGGAGCTGCAAAGG - Intronic
1051806315 9:20996565-20996587 CTCTGGATAGAGAGGTGTCAAGG + Intergenic
1053688775 9:40569050-40569072 CCCTGGGGAGGCAGGTGCCTGGG - Intergenic
1054275259 9:63062007-63062029 CCCTGGGGAGGCAGGTGCCTGGG + Intergenic
1054300015 9:63369961-63369983 CCCTGGGGAGGCAGGTGCCTGGG - Intergenic
1054399570 9:64702924-64702946 CCCTGGGGAGGCAGGTGCCTGGG - Intergenic
1054433153 9:65187189-65187211 CCCTGGGGAGGCAGGTGCCTGGG - Intergenic
1054497230 9:65834486-65834508 CCCTGGGGAGGCAGGTGCCTGGG + Intergenic
1056396364 9:86185152-86185174 CCCATGTGAGGGAGGTGCAAAGG + Intergenic
1057566371 9:96169281-96169303 CCCTTGTTAGTGAGGAGCCTGGG - Intergenic
1057794124 9:98143506-98143528 CCATGGTAAGGGATGTGGCAGGG - Intronic
1057985138 9:99705718-99705740 CCCTGGTTAGGGGGATGGCAAGG - Intergenic
1060433194 9:123568689-123568711 CCCTGCTTAGGGATGTGGCCAGG + Intronic
1060661742 9:125408639-125408661 CCCTGGTCAGGGAGGACGCAAGG + Intergenic
1061036942 9:128119186-128119208 CCCTGCTGAGGGAGGTACCCTGG + Intergenic
1062153988 9:135036008-135036030 CCCTGGGAAGGGAGGTGCAAGGG + Intergenic
1062572454 9:137191903-137191925 CCCTGATTTGGGAGGGTCCAAGG - Exonic
1185775973 X:2803379-2803401 CCCTGTTTAGGCAGGGGGCAAGG - Intronic
1191686694 X:63899457-63899479 CCCTGGTCAGGTAGGCACCAGGG - Intergenic
1193312642 X:80025799-80025821 CCCCGAGGAGGGAGGTGCCAAGG + Intronic
1193574753 X:83184048-83184070 ACCTGGATAGGGAGGAGCAAAGG + Intergenic
1193968643 X:88021921-88021943 ACCTGGTTAGGAAGATGACAGGG - Intergenic
1196434807 X:115665158-115665180 GCCTGGTGAGAGAGGTGCCCAGG - Intergenic
1197638970 X:128947253-128947275 CCAGGGTTAGCTAGGTGCCAGGG - Intergenic