ID: 1062869200

View in Genome Browser
Species Human (GRCh38)
Location 10:884596-884618
Sequence GTGAAATGTGCATTTCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062869200_1062869203 20 Left 1062869200 10:884596-884618 CCACCAAGAAATGCACATTTCAC 0: 1
1: 1
2: 0
3: 20
4: 227
Right 1062869203 10:884639-884661 TAAGATATTCAGAATGTAGGAGG 0: 1
1: 1
2: 1
3: 21
4: 230
1062869200_1062869202 17 Left 1062869200 10:884596-884618 CCACCAAGAAATGCACATTTCAC 0: 1
1: 1
2: 0
3: 20
4: 227
Right 1062869202 10:884636-884658 TCATAAGATATTCAGAATGTAGG 0: 1
1: 0
2: 1
3: 23
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062869200 Original CRISPR GTGAAATGTGCATTTCTTGG TGG (reversed) Intronic
903056558 1:20640225-20640247 GTGAACTGGGCATTTTTGGGGGG - Intronic
903304498 1:22403019-22403041 TTGAAATGTGGATGTGTTGGAGG - Intergenic
904819533 1:33232555-33232577 GTGAAAAATGCATTTCTGGCCGG - Intergenic
905801974 1:40850123-40850145 GTGCAATGTGGATTTCGTGTTGG + Intergenic
907765344 1:57405012-57405034 TTGAAATGTGCATATTTTAGTGG + Intronic
908347423 1:63249356-63249378 GTGAAATTTACATTGTTTGGTGG - Intergenic
908720780 1:67123309-67123331 GTTAAGTATGCATTTGTTGGAGG - Intronic
915520735 1:156441156-156441178 GGGAAATGTACAGTTCCTGGTGG + Intergenic
915633143 1:157167474-157167496 GTGACATGTGCCTGTCTTGTGGG + Intergenic
915703697 1:157823144-157823166 GTTTAATTTGCATTTCTTGGCGG + Intergenic
916322088 1:163515834-163515856 GTGAAGTGTGTTTTTCTTGTAGG - Intergenic
917971397 1:180210394-180210416 GTGAAATGTGGCCTTCATGGTGG + Intergenic
918027712 1:180768889-180768911 GTAAAATGGGCATTTATTGAAGG + Intronic
918194152 1:182206235-182206257 GGGGAATGTGCATTTCTAGCAGG + Intergenic
919455657 1:197817331-197817353 GTCAAATGTGCATTTATGGCTGG - Intergenic
920516699 1:206589947-206589969 TTGAAAGATACATTTCTTGGGGG - Intronic
922365434 1:224859106-224859128 GTACAATATGCAATTCTTGGTGG - Intergenic
923180076 1:231509055-231509077 GTGTAATGCGCAAGTCTTGGTGG - Intergenic
923251734 1:232184575-232184597 GGGCAAAGTGGATTTCTTGGAGG - Intergenic
923597114 1:235369184-235369206 GTGAAATGTGTAGTCCTTGGAGG - Intronic
923700649 1:236297053-236297075 TTTAAATGTACATTTGTTGGAGG + Intergenic
924501314 1:244641073-244641095 GTGACATGAGCAATTCTTTGTGG - Intronic
1062869200 10:884596-884618 GTGAAATGTGCATTTCTTGGTGG - Intronic
1064282339 10:13962527-13962549 GTGAAATATGCATTTTTTCAAGG + Intronic
1065610181 10:27465042-27465064 AGGAACTGGGCATTTCTTGGTGG - Intergenic
1066565655 10:36719193-36719215 GTAAGATGTGCATTTCTTTAGGG - Intergenic
1070494774 10:77011436-77011458 GTGGAAAGTTCTTTTCTTGGGGG + Intronic
1070507952 10:77132043-77132065 GTAATATGTGCATTTCTTGAAGG - Intronic
1071092949 10:81941381-81941403 TTGAAATGTGCATTTCTGAGTGG + Intronic
1072250296 10:93577019-93577041 TTGAAATGGGCATTCCCTGGGGG - Intronic
1072738567 10:97895985-97896007 GTGAAATCTGCATTGTTTGTAGG - Exonic
1073209289 10:101785822-101785844 GACAAATGTGCATTTGTTTGTGG - Exonic
1073719793 10:106155016-106155038 GTAAACTGTGTGTTTCTTGGCGG + Intergenic
1075128070 10:119716735-119716757 CTGAAATGTGAATATCTTGCAGG + Intergenic
1075544470 10:123344288-123344310 CAGAAATGTGACTTTCTTGGTGG + Intergenic
1079998228 11:27319168-27319190 GTCAGATTTGCATTTCTGGGAGG + Intergenic
1080112842 11:28588381-28588403 TTGAAATGTGGATTTTTTGGGGG - Intergenic
1083624139 11:64063448-64063470 GCGAATTGTGCTTTTCTTGAAGG + Intronic
1084125897 11:67098795-67098817 GGTACATTTGCATTTCTTGGTGG - Intergenic
1085742354 11:79088153-79088175 GTGAAATGTACCAGTCTTGGAGG + Intronic
1085920366 11:80948083-80948105 GTTAAATCAGCATTTCTTTGGGG - Intergenic
1086329696 11:85741560-85741582 GTGAAGATTTCATTTCTTGGAGG - Intronic
1086837933 11:91648658-91648680 GTCAGATGTGCAGATCTTGGTGG - Intergenic
1087789856 11:102394395-102394417 CTGATTTGTGCATTTTTTGGTGG + Intergenic
1088187456 11:107187630-107187652 GTAAACTGTGGATTTCTTTGGGG - Intergenic
1089777721 11:120850320-120850342 GTGTGATGTGTGTTTCTTGGGGG + Intronic
1091118311 11:133035637-133035659 TTGACATGTACATTTTTTGGGGG - Intronic
1096685947 12:53288361-53288383 GTGGAAGGTGCATGTTTTGGGGG + Intronic
1097502015 12:60415704-60415726 GTGAAAACTGCATTCTTTGGAGG - Intergenic
1097503574 12:60437290-60437312 GTGAAAGTTGCATGTGTTGGGGG + Intergenic
1097605941 12:61754590-61754612 ATGAAATGTTGATTTCTCGGTGG - Intronic
1098509000 12:71289998-71290020 CAGAAATCTGCATTTCTTTGGGG + Intronic
1100002159 12:89850307-89850329 GGGAAAGGAGCATTTCTTGGAGG + Intergenic
1100311931 12:93403729-93403751 ATAAAATGTGCATTTGGTGGGGG - Exonic
1101019557 12:100539720-100539742 CTGGAGTGTACATTTCTTGGGGG - Intronic
1101970365 12:109308725-109308747 GTGACATGTGTATTTCTCTGGGG + Intronic
1102851643 12:116251794-116251816 ATGTAAGGTGCATTTCTTGTAGG - Intronic
1103014384 12:117482477-117482499 AGGAAATGTGAATTTCTTGTTGG + Intronic
1104621643 12:130318417-130318439 GTGAACTGTGGATTTGTTTGGGG + Intergenic
1108222293 13:48248217-48248239 GTGCAACGTGCCTTTTTTGGGGG + Intronic
1108305732 13:49130534-49130556 GTGTTATGTGCATTTCCTGATGG - Intronic
1108436099 13:50403054-50403076 GTAGAATGTTCATTTCTTTGGGG + Intronic
1109357372 13:61247822-61247844 GGGAAATGTGGATTCCCTGGGGG + Intergenic
1110381818 13:74860848-74860870 GTGAAATTTGCATTCCCTGAAGG - Intergenic
1110577314 13:77073408-77073430 GTGAACTGTAGATTTTTTGGGGG - Intronic
1110982192 13:81915195-81915217 GTGAAATTTGCATATTTTGCTGG + Intergenic
1112827664 13:103410738-103410760 GTCAAATGTGCTTTTCTTCTTGG + Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1114004712 14:18299889-18299911 ATAAAATGTGCATTTCTTCATGG + Intergenic
1115849840 14:37582904-37582926 GTGAAGAGTCCATTGCTTGGAGG + Intergenic
1116535195 14:46018677-46018699 ATGAAAAGTGCATGCCTTGGAGG + Intergenic
1117280912 14:54240078-54240100 GTGAAATGTCCATATGCTGGAGG - Intergenic
1118966127 14:70587388-70587410 GTGATATGTGGCTTTGTTGGGGG - Intronic
1122847644 14:104509605-104509627 GTGAAATGTGCAGATCTTAAGGG - Intronic
1123389174 15:19852135-19852157 ATAAAATGTGCATTTCTTCATGG + Intergenic
1124271842 15:28289202-28289224 GTGTAAAGTGCATTTCTTTCAGG - Intronic
1126197256 15:45945989-45946011 TTCAAATGTGTATTTCTTTGTGG + Intergenic
1129077583 15:73010461-73010483 GCAAAATTTGCAGTTCTTGGGGG - Intergenic
1130753230 15:86735540-86735562 GTAAAATGTGCAATAGTTGGAGG - Intronic
1130943348 15:88530521-88530543 GTGAAATGTCTATTTCTGAGGGG + Intronic
1131514332 15:93067125-93067147 GTGAAATGTTCATTTAGTGATGG + Intronic
1131750461 15:95501623-95501645 CTGAAATGTAAGTTTCTTGGGGG - Intergenic
1133859806 16:9583915-9583937 ATAAAATGCCCATTTCTTGGGGG - Intergenic
1133879265 16:9765032-9765054 GTGAGATTTGCACTTCTTGCAGG + Intronic
1135231617 16:20713757-20713779 TTGAAATGTGCATATTTTGGGGG + Intronic
1137532225 16:49285494-49285516 GTGAAAATTTCATTTCTTTGTGG + Intergenic
1137616956 16:49854469-49854491 CTGAAAAGTTCATTTCCTGGAGG - Intronic
1138146412 16:54616263-54616285 CTGAAATATGCATCTCCTGGTGG + Intergenic
1140017438 16:71201126-71201148 GTGAAAAGTGCATTGCTGTGAGG - Intronic
1140584537 16:76274284-76274306 GTGAAATGAGCATGCCTAGGAGG - Intergenic
1140959733 16:79900286-79900308 GTGAAAAATGCAGCTCTTGGTGG + Intergenic
1141030501 16:80583688-80583710 CAAACATGTGCATTTCTTGGTGG - Intergenic
1141496045 16:84410361-84410383 CTGAAATGTGCACGTCTGGGTGG + Intronic
1141555023 16:84831384-84831406 GTTAAATGTCCAATGCTTGGGGG - Intronic
1141607123 16:85160384-85160406 GTTCAATGTGCATTTCTTCCGGG - Intergenic
1144638616 17:16925897-16925919 GTGGGATGTGCTTATCTTGGAGG - Intergenic
1146655327 17:34631597-34631619 GGGAAATGAGCATTTCTGGCAGG + Intronic
1147662792 17:42125911-42125933 GGGAAAAGTGCATTTGTTGGGGG + Intronic
1147928731 17:43962755-43962777 GTGCAATGGGCATTTTTTGGGGG + Intronic
1149193878 17:54096169-54096191 GGGAAATGTGCAATTCGTGGAGG + Intergenic
1153151086 18:2094199-2094221 GTGACATGATCATTTCTTGCAGG + Intergenic
1154532714 18:15363979-15364001 ATAAAATGTGCATTTCTTCATGG - Intergenic
1155130563 18:22930669-22930691 ATGAAATGGGCATTCCCTGGTGG - Intronic
1155543942 18:26895536-26895558 GTTAAGTGTGCATATCTTGCTGG + Intergenic
1157294185 18:46430585-46430607 GTGAAATGTGCAATTTCTGACGG + Intronic
1158453530 18:57587219-57587241 CTGGCAAGTGCATTTCTTGGAGG + Intergenic
1160610613 18:80082147-80082169 GTGAAAAGAGCACTTGTTGGTGG + Intronic
1164551914 19:29219138-29219160 GAGAAATGAACATTTTTTGGAGG + Intergenic
1164787123 19:30942498-30942520 GTGAAATGTCCAATTTTTGTCGG + Intergenic
1167310062 19:48732018-48732040 TTGAATTGTTCATTCCTTGGAGG - Intronic
1168534295 19:57156185-57156207 GTAAAATGGGCATTTCTGAGGGG - Intronic
925380900 2:3425256-3425278 GTGCAGTGTGCGTCTCTTGGTGG + Intronic
925860722 2:8172871-8172893 ATGAAATGTTCCTTTCTGGGTGG - Intergenic
926323687 2:11766322-11766344 GAGAAATAGGCTTTTCTTGGTGG + Intronic
926786051 2:16519391-16519413 GAGAAAGGGGCATTTCCTGGGGG + Intergenic
926850320 2:17190058-17190080 GTGACATGGGCCTTTCCTGGCGG - Intergenic
927353691 2:22149363-22149385 GGGAAATGTGAGTTTCTTGTAGG + Intergenic
928271093 2:29855393-29855415 GTGCCATGCTCATTTCTTGGGGG + Intronic
928308310 2:30189782-30189804 GTGAGACGTGCAGTTTTTGGGGG - Intergenic
930865554 2:56119257-56119279 GTGAAATTTGCTTTTGTGGGGGG + Intergenic
933213687 2:79601170-79601192 TTGAAATGTACATTTCCAGGAGG + Intronic
936259792 2:110948949-110948971 GTGAAATGTACGTGTCTCGGGGG - Intronic
938134691 2:128746337-128746359 CTGAAATATGCATTTATTAGGGG + Intergenic
938498605 2:131818030-131818052 GTGTACTGTGCTTTTCTTGAGGG + Intergenic
938531811 2:132195206-132195228 ATAAAATGTGCATTTCTTCATGG - Intronic
938573437 2:132583358-132583380 GGGATATGTGTATTTGTTGGGGG - Intronic
940768476 2:157815772-157815794 GTGAAATTTTTATTTTTTGGAGG - Intronic
941117537 2:161488920-161488942 ATGAAATGTGGACATCTTGGTGG - Intronic
942423235 2:175830366-175830388 GGAAACTGTGCATGTCTTGGAGG + Intergenic
942686346 2:178536326-178536348 GTGAAATGTGAAAATCTAGGTGG - Exonic
942688260 2:178557120-178557142 GTGATACGAACATTTCTTGGGGG + Exonic
943795586 2:191989144-191989166 CTAAAATGGTCATTTCTTGGGGG + Intronic
944074899 2:195718513-195718535 ATGAAATGTTCATTTCTGTGTGG + Intronic
944185068 2:196939278-196939300 TTGAAATGTGTTTTCCTTGGAGG - Intergenic
944633017 2:201646349-201646371 GTGAAATGTTCATTTAATGAAGG + Intronic
945331648 2:208546757-208546779 ATGAAATGTTCATTTCCTAGAGG + Intronic
945415887 2:209571992-209572014 GTGAAATATGAATATCTCGGAGG + Intronic
945966901 2:216197753-216197775 GTGCAATGTACTTTTTTTGGAGG - Intronic
948246072 2:236487249-236487271 TTGAGTTGTACATTTCTTGGAGG - Intronic
1169837575 20:9897659-9897681 GTGAAATGTGAATTTCTTGGAGG - Intergenic
1170900075 20:20453985-20454007 GTGCAAGGTGCATTTCTTGCTGG - Intronic
1176764648 21:13004232-13004254 ATAAAATGTGCATTTCTTCATGG + Intergenic
1177501277 21:21959181-21959203 GTGAAATGTGAAGTTGTTGAGGG + Intergenic
1178267976 21:31162359-31162381 CTTAAATGAGCAGTTCTTGGTGG - Intronic
1180429226 22:15230679-15230701 ATAAAATGTGCATTTCTTCATGG + Intergenic
1180511842 22:16099036-16099058 ATAAAATGTGCATTTCTTCATGG + Intergenic
1180881473 22:19206775-19206797 GTTACAAGTGCACTTCTTGGAGG - Intronic
1182575878 22:31272612-31272634 GCGCAAGGTGCGTTTCTTGGTGG - Exonic
1183029248 22:35090705-35090727 GTGCAATGTACATTACTTGAAGG - Intergenic
1183061859 22:35341008-35341030 GTGCAATGTGCTGTGCTTGGTGG - Intronic
1183972032 22:41484814-41484836 GTGAAATGTGCTTGTCATGTAGG + Intronic
949767334 3:7541744-7541766 ATGAAATCTGCATTTCTTACTGG + Intronic
953752527 3:45619835-45619857 GTAAAATGTGCTTTTTTTGGGGG - Intronic
955370236 3:58344917-58344939 CTGAAATGGGCATTTGCTGGGGG - Intronic
957254245 3:77815920-77815942 CTGAAATGTCCATTTCTTACAGG - Intergenic
958690438 3:97459289-97459311 GAAAAATGTGCATTTCTGGTGGG - Intronic
958883940 3:99705020-99705042 TTGAAAGGTACATTTCTTGCTGG - Intronic
959846334 3:111038061-111038083 AGGTAATGTGCATTTCTTGTAGG - Intergenic
960130034 3:114045879-114045901 ATGAAATATACATTTCTTGTGGG - Intronic
961563179 3:127745582-127745604 GTACAATGTACATTGCTTGGGGG + Intronic
964234545 3:154509862-154509884 GAGAAATGTGAATTTCTAGTGGG - Intergenic
965457207 3:168917303-168917325 GTGATTTGTGAATTTCTAGGAGG + Intergenic
965596236 3:170414162-170414184 CTGGAATGTGCATTTCTCTGTGG - Intergenic
965780910 3:172285083-172285105 GGGAAATGGGCATGTTTTGGGGG - Intronic
969385188 4:6840288-6840310 ATGAAATGTGCATTTCTGATTGG + Intronic
973388131 4:49528917-49528939 GTGCCATGTGCATTTTTTTGGGG + Intergenic
974113585 4:57553895-57553917 GTGAAATCTGCTTTTCCTAGCGG + Intergenic
974153973 4:58046580-58046602 GTGAAATCTACTTTTCTTGAAGG + Intergenic
974250306 4:59376486-59376508 ATGCAATGGGCATTTGTTGGAGG + Intergenic
977178332 4:93841397-93841419 TTGAAATGTTTATTGCTTGGTGG - Intergenic
977483758 4:97615040-97615062 GTAAACTGTGGATTTCTTTGGGG + Intronic
979029797 4:115628621-115628643 GTAAACTGTGCATTTCTGGAAGG - Intergenic
979161673 4:117469261-117469283 TTGAAATGGGCAGTTCTGGGAGG - Intergenic
980897151 4:138870816-138870838 GTCAAATGTTCATTTTTTAGGGG + Intergenic
983498571 4:168473448-168473470 GAGAGATGTGGATTTATTGGGGG + Intronic
986460226 5:7962826-7962848 GGGCAAAGTGCATTTCTAGGTGG + Intergenic
986930427 5:12812597-12812619 GTGAATTGTGTATTTCTCTGTGG - Intergenic
987741849 5:21919002-21919024 GTGAAATTTGCATTACTTGTAGG - Intronic
990982770 5:61616665-61616687 TTCAAATGTGCATTTCTGGCCGG + Intergenic
991982012 5:72242035-72242057 AGGAAATGTGTATTTCTTGGAGG + Intronic
993818954 5:92590206-92590228 GTCACATGTACAATTCTTGGTGG - Intergenic
999138892 5:149344077-149344099 GTTAAATGTACCTTTCTTGAAGG - Intergenic
999501483 5:152151071-152151093 GTGAAATGAGCATCTATTTGAGG - Intergenic
1000875279 5:166629866-166629888 TTGAAATGATCATTTCTGGGGGG - Intergenic
1003379430 6:5609868-5609890 GTGAAAAAGGCATTTGTTGGTGG - Intronic
1004450113 6:15737256-15737278 GTTAAATGTGAATTTCAGGGAGG + Intergenic
1005059797 6:21764892-21764914 GTGAATTTTGGATTTCTAGGGGG + Intergenic
1006106735 6:31721395-31721417 GAGAAATGGGTCTTTCTTGGAGG + Intronic
1007155014 6:39734246-39734268 GTGATAGGTGCATTTATGGGTGG + Intergenic
1009273581 6:61646688-61646710 GTGAAATATGTTTTTCTGGGAGG - Intergenic
1009502974 6:64441089-64441111 GTAAACTGTGAATTTCTTTGGGG - Intronic
1009830853 6:68931641-68931663 AGGAAATATTCATTTCTTGGGGG - Intronic
1009952007 6:70408707-70408729 GTTTAAAGTGGATTTCTTGGAGG - Intergenic
1012511560 6:100008428-100008450 ATTAACTGTGCATTTTTTGGGGG + Intergenic
1013674222 6:112439286-112439308 TTGAAATGTGCCATTCTAGGAGG - Intergenic
1013941989 6:115675509-115675531 CTTTAATTTGCATTTCTTGGAGG - Intergenic
1014411805 6:121133411-121133433 ATGACATGTGCATTTCATGAGGG - Intronic
1014667805 6:124261012-124261034 CTGAAATGAGAATTTCTTGCGGG - Intronic
1014965595 6:127744319-127744341 TTCAATTGTACATTTCTTGGAGG - Intronic
1015210526 6:130692981-130693003 GTGAGATATGCATGTGTTGGAGG + Intergenic
1020768869 7:12361728-12361750 ATGAATCATGCATTTCTTGGCGG + Intronic
1020921832 7:14274900-14274922 GTCAAATATGCATTTTTTGGGGG + Intronic
1023274698 7:38505761-38505783 TTGCAATATGCTTTTCTTGGTGG - Intronic
1024004956 7:45218487-45218509 GAGAATTGTGCATTTATTGTGGG + Intergenic
1024508387 7:50182752-50182774 GGGATATATGCATCTCTTGGCGG - Intergenic
1026261231 7:68757477-68757499 GAGAAATGAGTATTTCTTTGTGG + Intergenic
1030270738 7:107665931-107665953 GTGTAAGGTGAATTTCTGGGAGG + Intronic
1031100832 7:117478654-117478676 ATAAAATGTGCATTTCATGATGG - Intronic
1031656689 7:124364853-124364875 GGGAAATGTGGAGTTCTTTGCGG + Intergenic
1032034156 7:128509308-128509330 ATAAATTGTGAATTTCTTGGGGG + Intergenic
1032791704 7:135247296-135247318 GTGAGGAGTGCATTTCTTCGTGG - Intronic
1034787764 7:153941106-153941128 GAGAAATGTGCATTGCTTAATGG + Intronic
1035251061 7:157597368-157597390 TTGAAATATGCATTTGTTGGGGG + Intronic
1037264806 8:17046587-17046609 GTGAACTGTGAGTTACTTGGGGG + Intronic
1037902221 8:22694823-22694845 GGGGAACGTGCATTTCTCGGGGG + Intergenic
1045041479 8:98228443-98228465 GTGAAATGTGAATTTTGTGGGGG - Intronic
1046157658 8:110314157-110314179 GTAAAATATGCATTTCTAGGAGG + Intergenic
1046927692 8:119809920-119809942 ATGAAATGTGCATGTGTTGTTGG + Intronic
1047673063 8:127170097-127170119 GTTAAATGTGGTTTTCTGGGTGG - Intergenic
1048274947 8:133059046-133059068 ATGAAATGTGCAGTACCTGGAGG + Intronic
1048880718 8:138870281-138870303 GTGAACTGTGCATTTGTATGTGG + Intronic
1052002500 9:23303043-23303065 GAGGAATGGGCTTTTCTTGGAGG - Intergenic
1053314551 9:37040699-37040721 GGGCAATCTGCATTTGTTGGGGG + Intergenic
1053540562 9:38969430-38969452 GTCTAAAGTGCATTTCTAGGAGG + Intergenic
1053710423 9:40801698-40801720 ATAAAATGTGCATTTCTTCATGG - Intergenic
1054140376 9:61523871-61523893 GTCTAAAGTGCATTTCTAGGAGG - Intergenic
1054420331 9:64922487-64922509 ATAAAATGTGCATTTCTTCATGG - Intergenic
1054625580 9:67394493-67394515 GTCTAAAGTGCATTTCTAGGAGG - Intergenic
1056769399 9:89465974-89465996 GTGACTCCTGCATTTCTTGGAGG + Intronic
1056820621 9:89839453-89839475 GACAAATGTGCAGTTCTGGGAGG - Intergenic
1059250962 9:112887666-112887688 GTGAAATGTGTCTTTACTGGTGG + Intronic
1059868684 9:118546221-118546243 GTGCAAAGTGGATTTGTTGGTGG - Intergenic
1062333064 9:136053000-136053022 GTGGAATGTGCTCTTCCTGGGGG - Intronic
1185580416 X:1207558-1207580 GTAAAAGGGGCAGTTCTTGGGGG - Intronic
1186408696 X:9326760-9326782 GTGAAGTGTGCATATCAGGGGGG + Intergenic
1186664590 X:11704530-11704552 GTGCAAAGTACATTTCTTGGTGG + Intergenic
1187505010 X:19872338-19872360 GTGAAAGGTGAAATCCTTGGGGG - Intronic
1187684061 X:21798871-21798893 GAGTAATGTGCATTTCTTCCTGG - Intergenic
1187979670 X:24742340-24742362 GTGAAATGTGAAATTCTTTGAGG + Intronic
1189735794 X:44068383-44068405 GTGGAATTTTAATTTCTTGGGGG - Intergenic
1189905691 X:45756927-45756949 GCAAAATCAGCATTTCTTGGGGG - Intergenic
1190389661 X:49919772-49919794 TTGAAATGCACATTTTTTGGGGG + Intergenic
1190459708 X:50660400-50660422 GTTTAATGTACATTTTTTGGGGG - Intronic
1195534821 X:105999288-105999310 GTAAAATGTGAATCTATTGGAGG + Intergenic
1195588776 X:106599690-106599712 GTGAATTGGGCAATTCTTCGAGG + Intergenic
1196393192 X:115231563-115231585 GTTGAATGAGCATTTCTTGTGGG - Intronic
1197201060 X:123749008-123749030 TTGAAATGTGCATTTCTAACAGG + Intergenic
1198690229 X:139274794-139274816 GTGACTTGTGAATTTTTTGGTGG - Intergenic
1200019325 X:153188584-153188606 GGGAACTGTGCATTTCTTTATGG + Intergenic