ID: 1062869305

View in Genome Browser
Species Human (GRCh38)
Location 10:885712-885734
Sequence CAGAAGTCATGGGCTCCACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062869299_1062869305 -2 Left 1062869299 10:885691-885713 CCACAACCTTAGCGTCCTGATCA 0: 1
1: 0
2: 0
3: 13
4: 217
Right 1062869305 10:885712-885734 CAGAAGTCATGGGCTCCACTGGG 0: 1
1: 0
2: 0
3: 20
4: 141
1062869295_1062869305 29 Left 1062869295 10:885660-885682 CCCTCCTGGACTCTCTGCGTCTG 0: 1
1: 0
2: 1
3: 21
4: 321
Right 1062869305 10:885712-885734 CAGAAGTCATGGGCTCCACTGGG 0: 1
1: 0
2: 0
3: 20
4: 141
1062869298_1062869305 25 Left 1062869298 10:885664-885686 CCTGGACTCTCTGCGTCTGCGGT 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1062869305 10:885712-885734 CAGAAGTCATGGGCTCCACTGGG 0: 1
1: 0
2: 0
3: 20
4: 141
1062869300_1062869305 -8 Left 1062869300 10:885697-885719 CCTTAGCGTCCTGATCAGAAGTC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1062869305 10:885712-885734 CAGAAGTCATGGGCTCCACTGGG 0: 1
1: 0
2: 0
3: 20
4: 141
1062869296_1062869305 28 Left 1062869296 10:885661-885683 CCTCCTGGACTCTCTGCGTCTGC 0: 1
1: 0
2: 2
3: 34
4: 241
Right 1062869305 10:885712-885734 CAGAAGTCATGGGCTCCACTGGG 0: 1
1: 0
2: 0
3: 20
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062869305 Original CRISPR CAGAAGTCATGGGCTCCACT GGG Exonic
900314103 1:2048575-2048597 CAGGAGTGATGGGAACCACTGGG + Intergenic
900652438 1:3736459-3736481 CAGAAGGCCTGGGCCCCACAGGG - Intergenic
902509110 1:16955964-16955986 CAGAGGTCAGGGGCTGCCCTGGG - Intronic
906216542 1:44044205-44044227 CAGAAGGCAGGGACACCACTGGG + Intergenic
909402979 1:75254982-75255004 CACAGGTCATGGGCTCCACGTGG - Intronic
909513511 1:76481837-76481859 CAAATGTCTGGGGCTCCACTAGG + Intronic
913371314 1:118102914-118102936 TAGAAGCCATGGGCCCCTCTGGG - Intronic
916878112 1:168992102-168992124 CAGAAGTCCTGGGCTCCCTTTGG - Intergenic
918613081 1:186513857-186513879 CCTAAGTCTTGGGCTCCACCAGG + Intergenic
922448509 1:225717872-225717894 CAGAAGGCATGGGATCAACAGGG + Intergenic
922894522 1:229089870-229089892 CAGTACTCATTGGCTCCACTGGG - Intergenic
923161131 1:231315962-231315984 CAGGGGTCATGGGGGCCACTGGG + Intergenic
923858738 1:237871875-237871897 GAGAAGTCATGTGCTCCAGGTGG + Intergenic
1062869305 10:885712-885734 CAGAAGTCATGGGCTCCACTGGG + Exonic
1063503773 10:6578968-6578990 TAGAAGCCATGGTCCCCACTGGG - Intronic
1065053409 10:21818482-21818504 CAGAGGTCATGTGCTTCACAAGG - Intronic
1065179057 10:23106752-23106774 GAGAAGCCATGGCCTCCACTAGG - Intronic
1065665887 10:28060213-28060235 CAGAAGTATTTGGCTTCACTTGG - Intronic
1066071497 10:31819287-31819309 CAGAAAACCTGGGCTCCACTTGG + Intronic
1066236010 10:33485407-33485429 CAGAAGTCAGAGACTTCACTGGG - Intergenic
1067170215 10:43899745-43899767 CAGAGGACTTGGGCTGCACTGGG + Intergenic
1070646649 10:78206405-78206427 CACCAGTCCTGGGCCCCACTTGG - Intergenic
1071000646 10:80827480-80827502 CCTAAGTCTTGGGTTCCACTGGG - Intergenic
1071519146 10:86318269-86318291 CAGAAGTCATGGCCCCACCTTGG + Intronic
1074696037 10:116050952-116050974 CACAGGTCATTGGCTCCACTGGG + Intergenic
1075847053 10:125553215-125553237 CAGAAATCATGGGCTCACCTGGG - Intergenic
1081575091 11:44314189-44314211 ATGAAGTCATGTGCACCACTTGG + Intergenic
1081744728 11:45464839-45464861 CAGCAGCCAGGGTCTCCACTGGG + Intergenic
1083530460 11:63417334-63417356 TCAAAGTCTTGGGCTCCACTGGG - Intergenic
1083927134 11:65814784-65814806 CAGAAGTCATGGGATCTTCACGG - Intergenic
1083932634 11:65854277-65854299 CTGAAGTCCCGGGCTCCACCTGG + Intronic
1085279484 11:75320602-75320624 AAGAGGCCATGGGCTCCACATGG + Intronic
1089254835 11:117188739-117188761 CAGAGCTCATGGAGTCCACTCGG - Exonic
1091494390 12:959653-959675 AAGAAGTCCAGTGCTCCACTAGG + Intronic
1092033929 12:5314016-5314038 CAGAGGACATGGGCTACCCTAGG + Intergenic
1096462715 12:51831291-51831313 CAGCAGTCATGGGGAGCACTGGG + Intergenic
1096607129 12:52774941-52774963 CAGAGGTCCAGGGCTGCACTTGG - Intronic
1096816308 12:54203930-54203952 CAGAGATCATGGGCTCCTCAGGG - Intergenic
1097157720 12:57025206-57025228 CAGAAGTCACTGGCTACACAGGG + Intronic
1098087627 12:66864130-66864152 GAGAAGCCATGAGATCCACTCGG - Intergenic
1103715119 12:122940662-122940684 CAGGAGTTTTGGGCTCCAGTTGG - Intronic
1105277811 13:18945938-18945960 CAGAATCCATGGGATCCAGTTGG - Intergenic
1106602327 13:31199046-31199068 AAGAGGTCATGGGCTAAACTAGG + Intergenic
1107372559 13:39768401-39768423 CAGCAATCAAGAGCTCCACTGGG - Intronic
1108097757 13:46922459-46922481 CAGAAATCATGGGCGCCAGAAGG - Intergenic
1108259836 13:48645540-48645562 CAGAAACTATGGGCTCCTCTTGG - Intergenic
1111414412 13:87920130-87920152 CAGGAGTGATGGGCTCCAGCAGG - Intergenic
1111424890 13:88067523-88067545 CAGAAGTACTTGGATCCACTTGG - Intergenic
1117334059 14:54741855-54741877 CTCAAGCCATGGGATCCACTTGG - Intronic
1117961010 14:61161502-61161524 CAGAAATCATGGGCCCCACCAGG + Intergenic
1118425215 14:65653116-65653138 GAGCAGTCATGAGCCCCACTAGG + Intronic
1122258597 14:100499014-100499036 CTGAAGTCATGGGCAGCACTTGG - Intronic
1124176088 15:27425343-27425365 CAGAAGTGATGGTGGCCACTGGG + Intronic
1125395086 15:39238423-39238445 CAGATGTCATGGGCCTCAGTGGG - Intergenic
1127644837 15:60947735-60947757 CAGAAGTCATGGGTAGCACCTGG + Intronic
1127986731 15:64078560-64078582 CAGGAGTCAGAGGCTGCACTGGG + Intronic
1129117280 15:73371601-73371623 TAGAATTCAAGGGCTCCACAGGG + Intergenic
1130350150 15:83084331-83084353 CAGAAGAAATGAGCTCCCCTGGG - Intergenic
1130373918 15:83311223-83311245 CAGAAGTCATTGACTAAACTGGG + Intergenic
1131319263 15:91370387-91370409 CAGAATTCATGGGCAGCAATGGG + Intergenic
1132284542 15:100652750-100652772 GAGAAGTCATGAGATCCAGTGGG - Intergenic
1135145683 16:19960811-19960833 CAGAAGTGGTGGGATGCACTGGG - Intergenic
1135208504 16:20503482-20503504 CCTAGGTCTTGGGCTCCACTGGG - Intergenic
1135230853 16:20706533-20706555 CCTAGGTCTTGGGCTCCACTGGG - Intronic
1137233034 16:46585919-46585941 TAGAAGTCATGGTTCCCACTTGG - Intronic
1139696148 16:68676382-68676404 CAGTATTCATGGGCTGCCCTGGG + Exonic
1140195476 16:72851258-72851280 CAGAGGTCTTGGCCTCCCCTTGG - Intronic
1140682129 16:77395431-77395453 CACAAGTCATTCCCTCCACTGGG + Intronic
1141613671 16:85198149-85198171 CAGAAGCCCTGGCCACCACTGGG + Intergenic
1147299458 17:39513284-39513306 AAGAAGTGATTTGCTCCACTGGG - Intronic
1149163623 17:53724679-53724701 CCTAAGTTTTGGGCTCCACTGGG - Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1155156100 18:23158939-23158961 CAAACGTCATGTGCCCCACTGGG + Intronic
1157546950 18:48553363-48553385 CAGAGGTCTTTGGCTCAACTTGG - Intronic
1159742881 18:72194783-72194805 GTGAATTCACGGGCTCCACTAGG + Intergenic
1164503580 19:28839791-28839813 CTTAAGTCATGCCCTCCACTGGG - Intergenic
1164646701 19:29863643-29863665 CAGAATTCCTGGTCTCCTCTTGG + Intergenic
1168107372 19:54173070-54173092 CAGAAGCCTGGGGCTCCTCTAGG - Exonic
925049009 2:796642-796664 CAAGGGTCATGGGCTCCCCTTGG + Intergenic
926153062 2:10435239-10435261 CACAAGTCAGGGGCTCCTCTGGG - Intergenic
926295294 2:11564629-11564651 CAGAAGGCATGGACCACACTGGG + Intronic
926606088 2:14899807-14899829 CTGAAATCATGGGCTCCAGGTGG - Intergenic
928327797 2:30333900-30333922 CAGAGGTGATGGGGTCCAGTAGG - Intergenic
933592624 2:84249528-84249550 CAAAAGGCACGTGCTCCACTGGG - Intergenic
936054726 2:109253742-109253764 GAGAAATCATGGTCTCCACTTGG - Intronic
936247462 2:110840891-110840913 CAGGTGGCCTGGGCTCCACTTGG + Intronic
940346558 2:152634906-152634928 AAGAAGTCATGGTCACCATTTGG - Intronic
940934910 2:159481640-159481662 CAGAAGTGATGGACTCTTCTGGG - Intronic
942851599 2:180494391-180494413 CAGAAGGCTTGGGCCCCAGTGGG - Intergenic
944922837 2:204433398-204433420 CAGAGCTCAGGGGCACCACTGGG + Intergenic
945776855 2:214115995-214116017 CCTAAGTCTTGGGCTCCACTGGG - Intronic
946702861 2:222430158-222430180 AAGACTTCATGGGCTCCCCTGGG - Intronic
948544009 2:238712649-238712671 CAGAAGGGATGGGCACCACGCGG - Intergenic
948551413 2:238775384-238775406 CACAAGGCATGGACTCCACAAGG - Intergenic
949058499 2:241942999-241943021 CAGGAGTCAGGGGCTGCACTGGG + Intergenic
1168977432 20:1978054-1978076 CAGACCTCATGGGTTCCATTTGG - Intergenic
1174947348 20:55002754-55002776 CAGAAGTCATGGAGGCGACTTGG - Intergenic
1177746676 21:25223012-25223034 CCAATGTCTTGGGCTCCACTGGG + Intergenic
1180752785 22:18136699-18136721 CAGACGTGCTGGGCTCCACAGGG - Intronic
1180784636 22:18539979-18540001 CAGCAGTCCTGGGCTCACCTTGG - Intergenic
1181241539 22:21479336-21479358 CAGCAGTCCTGGGCTCACCTTGG - Intergenic
1185064881 22:48627108-48627130 CAGAAGACATGATTTCCACTCGG + Intronic
950763859 3:15258809-15258831 GGTAAGTCAGGGGCTCCACTGGG - Exonic
953285101 3:41598910-41598932 CAGAAATCAAGGTGTCCACTGGG + Intronic
954655904 3:52194156-52194178 TACAAGTCATGGTCCCCACTGGG - Intergenic
956700047 3:71951019-71951041 CAGAAGTCAGGGGCCACATTTGG + Intergenic
960465614 3:117993742-117993764 CAGAAGAGATGGATTCCACTTGG - Intergenic
964744967 3:160003722-160003744 CAGGGGTCATGGGGGCCACTGGG - Intergenic
964899962 3:161646792-161646814 CTGAGCTCATGGGATCCACTTGG - Intergenic
970415856 4:15856266-15856288 CAGAAGTCATGAGCTTCTCCAGG + Intergenic
971704392 4:30020866-30020888 CAGTAGTCATAGTCTACACTAGG + Intergenic
972246595 4:37251462-37251484 CAAAAGTCAGGGGTACCACTGGG + Intronic
983062365 4:163174156-163174178 CAGATGGAATGGGCACCACTAGG + Intergenic
983102605 4:163644305-163644327 CCTAGGTCTTGGGCTCCACTGGG - Intronic
983961790 4:173762909-173762931 CAGAAGTCATAGGATCCAAAAGG - Intergenic
985547753 5:518641-518663 CAGGAGCCAGGGGCTGCACTGGG - Intronic
987074602 5:14369228-14369250 AAGGAGCCATGGGCTCCACCTGG - Intronic
991405829 5:66300438-66300460 CATGAAGCATGGGCTCCACTTGG - Intergenic
993065930 5:83096567-83096589 CCTAAGTCTTGGGCTCCACTTGG + Intronic
998614753 5:143727823-143727845 CAGAAGTCCTAGGCTCAGCTTGG + Intergenic
998630608 5:143893839-143893861 CAGAGGTCACTGGTTCCACTTGG + Intergenic
1002853049 6:1013291-1013313 CAGAAGACATGGCCTCCTCGTGG - Intergenic
1007248515 6:40479765-40479787 TACAAGGCATGGGCTCCATTTGG + Intronic
1008841893 6:55912629-55912651 CAGAAGGCAAGAGCACCACTGGG - Intergenic
1009877621 6:69524868-69524890 CAGAAGGCATGGGCTGGAATTGG - Intergenic
1010201282 6:73284368-73284390 CAGGAGTCATGGGCCCCGGTAGG - Intronic
1017408719 6:154147243-154147265 GAGAAGAGATGGACTCCACTGGG - Intronic
1018323013 6:162633657-162633679 CACCAGTCATGGGGTGCACTGGG - Intronic
1019288439 7:235358-235380 CTCATGTCACGGGCTCCACTGGG - Intronic
1022327684 7:29346815-29346837 AAGAACACATGTGCTCCACTTGG - Intronic
1022643844 7:32212729-32212751 CAGAAGTGAATGGCTCCACCTGG - Intronic
1023061827 7:36334898-36334920 AAGAAGTCATGAGCTTCACTTGG - Intronic
1023995246 7:45155775-45155797 CAGAGGCCATGGGCACCACTGGG + Intergenic
1024486763 7:49928197-49928219 CAGGAGTCATGTTGTCCACTGGG + Intronic
1025116777 7:56264967-56264989 CAGAAATCATGTGCTTCACAAGG - Intergenic
1026939800 7:74280995-74281017 CAGAAGACTTGGGCTCCAGCCGG - Intergenic
1035401862 7:158570803-158570825 CAAAAGCCATGAGCTCCACAGGG - Intronic
1036443853 8:8804846-8804868 CTGAGGTCATGGGCTCCAGGTGG - Intronic
1038921654 8:32091619-32091641 CAGGTGTCATGGGCTCTACAAGG + Intronic
1041463211 8:58133809-58133831 CAGCAGACGTGGGCTCCACTGGG - Intronic
1042057484 8:64781397-64781419 CAGAAGACATGGGCCTCACTGGG + Intronic
1047028700 8:120852554-120852576 CAAAAATCACAGGCTCCACTTGG - Intergenic
1047504615 8:125469311-125469333 CAGAAGCCAGGAGCTGCACTGGG - Intergenic
1047705992 8:127500101-127500123 CAGAAATCCTTGGCTCCAGTGGG - Intergenic
1048912436 8:139148772-139148794 CTGCAGTCTTGGGCTCCTCTGGG + Intergenic
1048967638 8:139625905-139625927 CAGAAGTCATGGCAGCCACCAGG + Intronic
1049169027 8:141146959-141146981 CAGCAGTAATGAGCTGCACTCGG + Intronic
1051963712 9:22800750-22800772 CCTCAGTCTTGGGCTCCACTGGG - Intergenic
1052863855 9:33453243-33453265 AAGAAGTCATGGGCTCCCACGGG - Intergenic
1053306748 9:36989791-36989813 CAGAAGCCATGGGCTCATCTGGG - Intronic
1055493686 9:76832921-76832943 TAGAAGACATGGACACCACTAGG + Intronic
1055610831 9:78022188-78022210 CAGCAGTGATGGGCTCTACTAGG - Intronic
1055710365 9:79054391-79054413 CAGAAGTAATGGACTACTCTTGG + Intergenic
1056274763 9:84983376-84983398 CAGCAGTCAAGGCTTCCACTGGG + Intronic
1056769492 9:89466506-89466528 CAGAGGTCATGGGCAGCCCTCGG - Intronic
1058875923 9:109244745-109244767 CAGAAGTCAGGGGCTTCTCAAGG + Intronic
1062178191 9:135175949-135175971 AAGAAGCCATGGTTTCCACTGGG - Intergenic
1062611005 9:137373408-137373430 CAGAACCCATGGGCTCACCTGGG + Exonic
1188883456 X:35519138-35519160 CTGAAGTCATGAGCTGCCCTTGG - Intergenic
1189409403 X:40756285-40756307 CCTAGGTCTTGGGCTCCACTGGG + Intergenic
1191762540 X:64661579-64661601 CATAAGTCAGGTGCCCCACTGGG - Intergenic
1198797302 X:140410725-140410747 CAGCAGTCATAGGCTTCACACGG + Intergenic