ID: 1062871209

View in Genome Browser
Species Human (GRCh38)
Location 10:906483-906505
Sequence ACCTGTGGGTTGCACCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062871209_1062871216 22 Left 1062871209 10:906483-906505 CCAGTGTGGTGCAACCCACAGGT 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1062871216 10:906528-906550 TTGATCCTGGTGACAGGCCACGG No data
1062871209_1062871215 16 Left 1062871209 10:906483-906505 CCAGTGTGGTGCAACCCACAGGT 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1062871215 10:906522-906544 ACAGCGTTGATCCTGGTGACAGG No data
1062871209_1062871213 9 Left 1062871209 10:906483-906505 CCAGTGTGGTGCAACCCACAGGT 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1062871213 10:906515-906537 TCCACAGACAGCGTTGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062871209 Original CRISPR ACCTGTGGGTTGCACCACAC TGG (reversed) Intronic
900205218 1:1428523-1428545 ACCTGTGGCTTACACCAAACAGG - Intergenic
900650529 1:3727991-3728013 CCCTGTGGGTTGCTCACCACCGG + Intronic
901855321 1:12040902-12040924 AGCTGTGTGTTGCAGAACACTGG + Intergenic
902706902 1:18211967-18211989 ACCTGTTGGCTGCTCCACATGGG - Intronic
907499803 1:54870704-54870726 ATCTGTGGGTTCCACAACAGTGG - Intronic
912713228 1:111964352-111964374 ACCTGCGGGCTGCAGTACACAGG + Intronic
918508223 1:185281133-185281155 ATATTTGGGTGGCACCACACAGG + Intronic
920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG + Intronic
924408304 1:243775545-243775567 ACCTGTGGGATCCACCAAAGAGG + Intronic
1062871209 10:906483-906505 ACCTGTGGGTTGCACCACACTGG - Intronic
1085467940 11:76736919-76736941 GCCTGTGGGGTGCCCCACACTGG - Intergenic
1088050370 11:105507045-105507067 ATTTGTGGGTTGCACAACAATGG - Intergenic
1091704493 12:2684632-2684654 CCCTGGGGGTTGTACCACTCTGG - Intronic
1092455229 12:8637061-8637083 TCCTGTGGGTGCCGCCACACTGG + Intergenic
1099790465 12:87327425-87327447 TCCAGTGGGTTGCATAACACGGG - Intergenic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1113318393 13:109208173-109208195 ACCTGTTGGTCTCACCATACTGG - Intergenic
1117974944 14:61287874-61287896 ACCAGTGAGTTTCACTACACTGG - Intronic
1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG + Exonic
1119878018 14:78076869-78076891 ACCTGTGGGTGGCACCAAGTTGG - Intergenic
1121251323 14:92501760-92501782 ACCTGTAGGTGGCCCCACATTGG + Intergenic
1121597209 14:95173390-95173412 ACCAGTGGGATGCACCGTACTGG - Intergenic
1127817027 15:62620115-62620137 ACAGCTGGGTTCCACCACACCGG + Intronic
1131387402 15:92018703-92018725 ACCTGTGGGCTGCACCTGAGTGG + Intronic
1135166297 16:20141969-20141991 AACTGTGGTTTGCACTAGACCGG - Intergenic
1136717266 16:32290518-32290540 ACCAGTGGCCAGCACCACACTGG - Intergenic
1136835641 16:33496772-33496794 ACCAGTGGCCAGCACCACACTGG - Intergenic
1137675578 16:50302169-50302191 ACCTGCGGGTGCCACCACCCTGG - Intronic
1140925950 16:79583666-79583688 AACTGTGGTTTGCACCAAAGTGG - Intergenic
1203009163 16_KI270728v1_random:227260-227282 ACCAGTGGCCAGCACCACACTGG + Intergenic
1203145820 16_KI270728v1_random:1797087-1797109 ACCAGTGGCCAGCACCACACTGG - Intergenic
1143180147 17:4979682-4979704 ACCTCTGGGTAGGACCACTCTGG + Exonic
1143207283 17:5152852-5152874 ACAGGTGTGTGGCACCACACCGG - Intronic
1144633581 17:16888885-16888907 GGCTGTGGGTGGCATCACACTGG - Intergenic
1146095317 17:29924654-29924676 AGCTGTTGGTTTCACCACAAGGG - Intronic
1146152641 17:30488678-30488700 ACAGGTGCGTTCCACCACACCGG + Intronic
1146592547 17:34140242-34140264 ACCTGAGGGTAACACGACACAGG + Intronic
1146630207 17:34464114-34464136 GCCTGTGGGGGGCACAACACTGG + Intergenic
1148071323 17:44910536-44910558 GCCTGTAGGTTGCTCCAGACTGG - Exonic
1149868488 17:60163292-60163314 GCCTCAGGGTTGCACCACGCTGG - Intronic
1152563506 17:81090086-81090108 ACCTGTGGGTGGCCCCAGGCTGG + Intronic
1153197611 18:2618100-2618122 ACATGTGGCTGGTACCACACTGG - Intergenic
1153428833 18:4993183-4993205 ACCTGAGGGTGGCTCAACACAGG - Intergenic
1157708892 18:49834387-49834409 ACCTGTGGGGAGCACCTCAGGGG - Intronic
1159413088 18:68106354-68106376 ACCTGTAGGTTCTACAACACTGG - Intergenic
1161594319 19:5143524-5143546 CCCTGGGGGTTGCAGAACACGGG + Intronic
1164884044 19:31761716-31761738 GCCTGTGGTTGGCACCCCACAGG - Intergenic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
927813456 2:26193700-26193722 TCCTGTGGGTGCCGCCACACTGG - Exonic
929055162 2:37870267-37870289 ACCAATGGGTTGCTCCAAACAGG + Intergenic
929800582 2:45097257-45097279 ACAGGTGTGTGGCACCACACAGG - Intergenic
936092810 2:109511909-109511931 TGCTGTGGGCAGCACCACACTGG - Intergenic
943392708 2:187289669-187289691 AACTGTGGGTTCCAACACATTGG + Intergenic
947541884 2:230985481-230985503 ACCTGTGGGTCTCACGACTCAGG + Intergenic
947732053 2:232436741-232436763 GCATGTGGGTGGCACCACGCGGG + Intergenic
948247620 2:236499614-236499636 AGATGGGGGTTTCACCACACTGG + Intronic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1172411599 20:34727909-34727931 AGATGGGGGTTTCACCACACTGG + Intronic
1172706988 20:36889193-36889215 GCCTGGGGGTTTCAGCACACAGG + Intronic
1173598696 20:44277508-44277530 ACCTGGGGGCTGGATCACACAGG + Intronic
1174116662 20:48230989-48231011 GCCTGTGGGCTGCACCTCCCAGG + Intergenic
1180165269 21:46022502-46022524 TCCTGAGGGTGCCACCACACGGG + Intergenic
1183792175 22:40080996-40081018 ACATGTGTGTGTCACCACACTGG + Intronic
1185269260 22:49921379-49921401 GCCTGTGGCTTGCTCCACTCAGG + Intronic
953637882 3:44677968-44677990 CCCTGTGGGTGGCATCACCCTGG - Intergenic
955858308 3:63298517-63298539 CCCTGTGAGTTTCAGCACACAGG - Intronic
958920852 3:100103736-100103758 ACCTTTGGGTTTCACTTCACTGG + Intronic
963459667 3:145594060-145594082 AACTGTGGGGTGCAGCATACAGG + Intergenic
963778499 3:149464029-149464051 ACCTGCGTGATGCACTACACCGG - Intergenic
971179654 4:24317347-24317369 ACCTGTGGGTTTCACTGGACTGG - Intergenic
972562581 4:40241746-40241768 ACATGTGTGTGCCACCACACCGG - Intronic
977875021 4:102139511-102139533 TGCTGTGGGTTGCACCACTCTGG + Intergenic
978380384 4:108121838-108121860 ACCTGTTGGCTGCACATCACTGG + Intronic
983256326 4:165404595-165404617 TCCTGTGGGTGCCGCCACACTGG - Intronic
985634634 5:1030036-1030058 CCCTGGGGGCTTCACCACACAGG + Intronic
992373064 5:76165080-76165102 ACCTGTGGGTTCCACCTCTGTGG - Intronic
995367892 5:111384448-111384470 ACCTGTGGCTTGAGCCACACTGG + Intronic
998189197 5:140008083-140008105 AGATGTGGGGAGCACCACACAGG + Intronic
999442827 5:151615585-151615607 ACCTGTGGTTTGCACAAGTCAGG - Intergenic
1004118197 6:12791853-12791875 GCCTGAGGGTTGCACCATAGTGG + Intronic
1004356130 6:14931459-14931481 CCCTGTGAGTTGCTCCTCACTGG - Intergenic
1006153774 6:32003165-32003187 ACCTGAGGATTGCACAACTCCGG - Intergenic
1006160082 6:32035902-32035924 ACCTGAGGATTGCACAACTCCGG - Intergenic
1008825881 6:55693016-55693038 ACATGTGTGTGCCACCACACTGG - Intergenic
1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG + Exonic
1012037878 6:94166039-94166061 TCCTGTGGCTTGCAGCACAGTGG + Intergenic
1017819625 6:158039840-158039862 ACCTGCGGGCGGCACCACAAGGG - Intronic
1018329567 6:162712676-162712698 ATCTCTGGCTTGCACCACATAGG + Intronic
1019443045 7:1056969-1056991 ACCTGTGGGTCGCAGCCCACAGG - Intronic
1027761590 7:82285579-82285601 AGCTTTGGGTTGCAGCACATTGG + Intronic
1027867253 7:83663400-83663422 AGCTGTGAGGTGCACAACACAGG + Intergenic
1027878564 7:83802421-83802443 ACCTGTGGGTTGGCCAACAAGGG + Intergenic
1030131801 7:106207819-106207841 AACTGTGATTTGCTCCACACTGG - Intergenic
1030386096 7:108870235-108870257 ACCTGTGGGATGCAGCATGCAGG + Intergenic
1035477889 7:159156583-159156605 ACCAGGGGTTTGCTCCACACCGG - Intergenic
1037679672 8:21086373-21086395 AACTGTGGATTGGACCACAGTGG + Intergenic
1044725254 8:95189659-95189681 TCCTGTGGGCAACACCACACAGG - Intergenic
1056627445 9:88265199-88265221 ACCTGTGGGCTTCACCATAGTGG - Intergenic
1060525032 9:124315642-124315664 ACCTGTGGGTTCCTTCACTCGGG - Intronic
1062216264 9:135391311-135391333 ACCTCTGGATCACACCACACTGG - Intergenic
1186415853 X:9382496-9382518 ACATGGGGGTTGCCCCACCCAGG + Intergenic
1189265015 X:39708424-39708446 ACCTGTGGGTTGCATTAAAAAGG + Intergenic
1191022513 X:55877815-55877837 TGCTGTGGCTTGCACAACACTGG + Intergenic
1194323566 X:92481485-92481507 ACTGGTGGACTGCACCACACTGG - Intronic
1197250075 X:124206561-124206583 ACAGGTGGGTGCCACCACACCGG + Intronic
1200631667 Y:5594647-5594669 ACTGGTGGACTGCACCACACTGG - Intronic