ID: 1062873144

View in Genome Browser
Species Human (GRCh38)
Location 10:924149-924171
Sequence TGGCAAGATCGCTCAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062873142_1062873144 -1 Left 1062873142 10:924127-924149 CCAGCTACTCGGGAGGCTAAGGT 0: 307
1: 11002
2: 144962
3: 309101
4: 215276
Right 1062873144 10:924149-924171 TGGCAAGATCGCTCAAGCCCAGG No data
1062873132_1062873144 28 Left 1062873132 10:924098-924120 CCAGGTGTGGTGGCATGCACCCA 0: 13
1: 171
2: 2181
3: 9106
4: 29293
Right 1062873144 10:924149-924171 TGGCAAGATCGCTCAAGCCCAGG No data
1062873140_1062873144 0 Left 1062873140 10:924126-924148 CCCAGCTACTCGGGAGGCTAAGG 0: 2655
1: 111276
2: 295498
3: 224622
4: 127132
Right 1062873144 10:924149-924171 TGGCAAGATCGCTCAAGCCCAGG No data
1062873136_1062873144 9 Left 1062873136 10:924117-924139 CCCATGGGTCCCAGCTACTCGGG 0: 1
1: 4
2: 41
3: 379
4: 2082
Right 1062873144 10:924149-924171 TGGCAAGATCGCTCAAGCCCAGG No data
1062873138_1062873144 8 Left 1062873138 10:924118-924140 CCATGGGTCCCAGCTACTCGGGA 0: 2
1: 39
2: 3569
3: 76449
4: 210908
Right 1062873144 10:924149-924171 TGGCAAGATCGCTCAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062873144 Original CRISPR TGGCAAGATCGCTCAAGCCC AGG Intronic
No off target data available for this crispr