ID: 1062881806

View in Genome Browser
Species Human (GRCh38)
Location 10:985066-985088
Sequence GTGTCTCTCCAGCTGTGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062881802_1062881806 2 Left 1062881802 10:985041-985063 CCATGCGCCCTGAACGCACCTCA No data
Right 1062881806 10:985066-985088 GTGTCTCTCCAGCTGTGTGACGG No data
1062881803_1062881806 -5 Left 1062881803 10:985048-985070 CCCTGAACGCACCTCATTGTGTC No data
Right 1062881806 10:985066-985088 GTGTCTCTCCAGCTGTGTGACGG No data
1062881804_1062881806 -6 Left 1062881804 10:985049-985071 CCTGAACGCACCTCATTGTGTCT No data
Right 1062881806 10:985066-985088 GTGTCTCTCCAGCTGTGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062881806 Original CRISPR GTGTCTCTCCAGCTGTGTGA CGG Intergenic
No off target data available for this crispr