ID: 1062882174 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:988045-988067 |
| Sequence | TAGGGGATCCGGGAGTCTGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 131 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 117} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1062882174_1062882190 | 26 | Left | 1062882174 | 10:988045-988067 | CCCCCAGACTCCCGGATCCCCTA | 0: 1 1: 0 2: 0 3: 13 4: 117 |
||
| Right | 1062882190 | 10:988094-988116 | ACTCCCAAATCCCAAGACCCCGG | 0: 1 1: 0 2: 3 3: 23 4: 287 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1062882174 | Original CRISPR | TAGGGGATCCGGGAGTCTGG GGG (reversed) | Exonic | ||