ID: 1062882175

View in Genome Browser
Species Human (GRCh38)
Location 10:988046-988068
Sequence CTAGGGGATCCGGGAGTCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062882175_1062882190 25 Left 1062882175 10:988046-988068 CCCCAGACTCCCGGATCCCCTAG 0: 1
1: 0
2: 2
3: 4
4: 141
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062882175 Original CRISPR CTAGGGGATCCGGGAGTCTG GGG (reversed) Exonic