ID: 1062882176

View in Genome Browser
Species Human (GRCh38)
Location 10:988047-988069
Sequence TCTAGGGGATCCGGGAGTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062882176_1062882190 24 Left 1062882176 10:988047-988069 CCCAGACTCCCGGATCCCCTAGA 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062882176 Original CRISPR TCTAGGGGATCCGGGAGTCT GGG (reversed) Exonic