ID: 1062882177 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:988048-988070 |
| Sequence | GTCTAGGGGATCCGGGAGTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 81 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 2, 4: 77} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1062882177_1062882190 | 23 | Left | 1062882177 | 10:988048-988070 | CCAGACTCCCGGATCCCCTAGAC | 0: 1 1: 0 2: 1 3: 2 4: 77 |
||
| Right | 1062882190 | 10:988094-988116 | ACTCCCAAATCCCAAGACCCCGG | 0: 1 1: 0 2: 3 3: 23 4: 287 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1062882177 | Original CRISPR | GTCTAGGGGATCCGGGAGTC TGG (reversed) | Exonic | ||