ID: 1062882178

View in Genome Browser
Species Human (GRCh38)
Location 10:988055-988077
Sequence CCAGAGGGTCTAGGGGATCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062882178_1062882190 16 Left 1062882178 10:988055-988077 CCCGGATCCCCTAGACCCTCTGG 0: 1
1: 0
2: 4
3: 19
4: 206
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062882178 Original CRISPR CCAGAGGGTCTAGGGGATCC GGG (reversed) Exonic