ID: 1062882180

View in Genome Browser
Species Human (GRCh38)
Location 10:988056-988078
Sequence TCCAGAGGGTCTAGGGGATC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062882180_1062882190 15 Left 1062882180 10:988056-988078 CCGGATCCCCTAGACCCTCTGGA 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882180_1062882195 30 Left 1062882180 10:988056-988078 CCGGATCCCCTAGACCCTCTGGA 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1062882195 10:988109-988131 GACCCCGGACCCTCCAACCCTGG 0: 1
1: 0
2: 0
3: 13
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062882180 Original CRISPR TCCAGAGGGTCTAGGGGATC CGG (reversed) Exonic