ID: 1062882183

View in Genome Browser
Species Human (GRCh38)
Location 10:988064-988086
Sequence CTTAGGAGTCCAGAGGGTCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062882183_1062882195 22 Left 1062882183 10:988064-988086 CCTAGACCCTCTGGACTCCTAAG 0: 1
1: 0
2: 4
3: 19
4: 186
Right 1062882195 10:988109-988131 GACCCCGGACCCTCCAACCCTGG 0: 1
1: 0
2: 0
3: 13
4: 193
1062882183_1062882199 28 Left 1062882183 10:988064-988086 CCTAGACCCTCTGGACTCCTAAG 0: 1
1: 0
2: 4
3: 19
4: 186
Right 1062882199 10:988115-988137 GGACCCTCCAACCCTGGCCCAGG 0: 1
1: 0
2: 1
3: 141
4: 959
1062882183_1062882190 7 Left 1062882183 10:988064-988086 CCTAGACCCTCTGGACTCCTAAG 0: 1
1: 0
2: 4
3: 19
4: 186
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882183_1062882200 29 Left 1062882183 10:988064-988086 CCTAGACCCTCTGGACTCCTAAG 0: 1
1: 0
2: 4
3: 19
4: 186
Right 1062882200 10:988116-988138 GACCCTCCAACCCTGGCCCAGGG 0: 1
1: 0
2: 4
3: 45
4: 969

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062882183 Original CRISPR CTTAGGAGTCCAGAGGGTCT AGG (reversed) Exonic