ID: 1062882184

View in Genome Browser
Species Human (GRCh38)
Location 10:988070-988092
Sequence GCGGGGCTTAGGAGTCCAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062882184_1062882204 30 Left 1062882184 10:988070-988092 CCCTCTGGACTCCTAAGCCCCGC 0: 1
1: 0
2: 3
3: 9
4: 106
Right 1062882204 10:988123-988145 CAACCCTGGCCCAGGGCGCGTGG 0: 1
1: 0
2: 0
3: 15
4: 184
1062882184_1062882190 1 Left 1062882184 10:988070-988092 CCCTCTGGACTCCTAAGCCCCGC 0: 1
1: 0
2: 3
3: 9
4: 106
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882184_1062882200 23 Left 1062882184 10:988070-988092 CCCTCTGGACTCCTAAGCCCCGC 0: 1
1: 0
2: 3
3: 9
4: 106
Right 1062882200 10:988116-988138 GACCCTCCAACCCTGGCCCAGGG 0: 1
1: 0
2: 4
3: 45
4: 969
1062882184_1062882195 16 Left 1062882184 10:988070-988092 CCCTCTGGACTCCTAAGCCCCGC 0: 1
1: 0
2: 3
3: 9
4: 106
Right 1062882195 10:988109-988131 GACCCCGGACCCTCCAACCCTGG 0: 1
1: 0
2: 0
3: 13
4: 193
1062882184_1062882199 22 Left 1062882184 10:988070-988092 CCCTCTGGACTCCTAAGCCCCGC 0: 1
1: 0
2: 3
3: 9
4: 106
Right 1062882199 10:988115-988137 GGACCCTCCAACCCTGGCCCAGG 0: 1
1: 0
2: 1
3: 141
4: 959

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062882184 Original CRISPR GCGGGGCTTAGGAGTCCAGA GGG (reversed) Exonic