ID: 1062882186

View in Genome Browser
Species Human (GRCh38)
Location 10:988081-988103
Sequence ATTTGGGAGTTGCGGGGCTT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 158}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062882186_1062882195 5 Left 1062882186 10:988081-988103 CCTAAGCCCCGCAACTCCCAAAT 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1062882195 10:988109-988131 GACCCCGGACCCTCCAACCCTGG 0: 1
1: 0
2: 0
3: 13
4: 193
1062882186_1062882208 24 Left 1062882186 10:988081-988103 CCTAAGCCCCGCAACTCCCAAAT 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1062882208 10:988128-988150 CTGGCCCAGGGCGCGTGGCTGGG 0: 1
1: 0
2: 1
3: 37
4: 296
1062882186_1062882199 11 Left 1062882186 10:988081-988103 CCTAAGCCCCGCAACTCCCAAAT 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1062882199 10:988115-988137 GGACCCTCCAACCCTGGCCCAGG 0: 1
1: 0
2: 1
3: 141
4: 959
1062882186_1062882207 23 Left 1062882186 10:988081-988103 CCTAAGCCCCGCAACTCCCAAAT 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1062882207 10:988127-988149 CCTGGCCCAGGGCGCGTGGCTGG 0: 1
1: 0
2: 4
3: 42
4: 411
1062882186_1062882204 19 Left 1062882186 10:988081-988103 CCTAAGCCCCGCAACTCCCAAAT 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1062882204 10:988123-988145 CAACCCTGGCCCAGGGCGCGTGG 0: 1
1: 0
2: 0
3: 15
4: 184
1062882186_1062882200 12 Left 1062882186 10:988081-988103 CCTAAGCCCCGCAACTCCCAAAT 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1062882200 10:988116-988138 GACCCTCCAACCCTGGCCCAGGG 0: 1
1: 0
2: 4
3: 45
4: 969
1062882186_1062882210 26 Left 1062882186 10:988081-988103 CCTAAGCCCCGCAACTCCCAAAT 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1062882210 10:988130-988152 GGCCCAGGGCGCGTGGCTGGGGG 0: 1
1: 1
2: 2
3: 61
4: 420
1062882186_1062882209 25 Left 1062882186 10:988081-988103 CCTAAGCCCCGCAACTCCCAAAT 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1062882209 10:988129-988151 TGGCCCAGGGCGCGTGGCTGGGG 0: 1
1: 0
2: 2
3: 31
4: 301
1062882186_1062882190 -10 Left 1062882186 10:988081-988103 CCTAAGCCCCGCAACTCCCAAAT 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062882186 Original CRISPR ATTTGGGAGTTGCGGGGCTT AGG (reversed) Exonic