ID: 1062882190

View in Genome Browser
Species Human (GRCh38)
Location 10:988094-988116
Sequence ACTCCCAAATCCCAAGACCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 287}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062882185_1062882190 0 Left 1062882185 10:988071-988093 CCTCTGGACTCCTAAGCCCCGCA 0: 1
1: 0
2: 2
3: 10
4: 123
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882177_1062882190 23 Left 1062882177 10:988048-988070 CCAGACTCCCGGATCCCCTAGAC 0: 1
1: 0
2: 1
3: 2
4: 77
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882183_1062882190 7 Left 1062882183 10:988064-988086 CCTAGACCCTCTGGACTCCTAAG 0: 1
1: 0
2: 4
3: 19
4: 186
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882182_1062882190 8 Left 1062882182 10:988063-988085 CCCTAGACCCTCTGGACTCCTAA 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882176_1062882190 24 Left 1062882176 10:988047-988069 CCCAGACTCCCGGATCCCCTAGA 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882178_1062882190 16 Left 1062882178 10:988055-988077 CCCGGATCCCCTAGACCCTCTGG 0: 1
1: 0
2: 4
3: 19
4: 206
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882184_1062882190 1 Left 1062882184 10:988070-988092 CCCTCTGGACTCCTAAGCCCCGC 0: 1
1: 0
2: 3
3: 9
4: 106
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882186_1062882190 -10 Left 1062882186 10:988081-988103 CCTAAGCCCCGCAACTCCCAAAT 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882181_1062882190 9 Left 1062882181 10:988062-988084 CCCCTAGACCCTCTGGACTCCTA 0: 1
1: 0
2: 0
3: 6
4: 146
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882174_1062882190 26 Left 1062882174 10:988045-988067 CCCCCAGACTCCCGGATCCCCTA 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882180_1062882190 15 Left 1062882180 10:988056-988078 CCGGATCCCCTAGACCCTCTGGA 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287
1062882175_1062882190 25 Left 1062882175 10:988046-988068 CCCCAGACTCCCGGATCCCCTAG 0: 1
1: 0
2: 2
3: 4
4: 141
Right 1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG 0: 1
1: 0
2: 3
3: 23
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062882190 Original CRISPR ACTCCCAAATCCCAAGACCC CGG Exonic