ID: 1062884313 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:1004815-1004837 |
| Sequence | CAGTTTAGCCTCAGGGATGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1062884310_1062884313 | -1 | Left | 1062884310 | 10:1004793-1004815 | CCAGGTTTGGGTAGTTTGGAGGC | 0: 1 1: 0 2: 0 3: 3 4: 96 |
||
| Right | 1062884313 | 10:1004815-1004837 | CAGTTTAGCCTCAGGGATGAAGG | No data | ||||
| 1062884308_1062884313 | 2 | Left | 1062884308 | 10:1004790-1004812 | CCACCAGGTTTGGGTAGTTTGGA | 0: 1 1: 0 2: 0 3: 8 4: 149 |
||
| Right | 1062884313 | 10:1004815-1004837 | CAGTTTAGCCTCAGGGATGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1062884313 | Original CRISPR | CAGTTTAGCCTCAGGGATGA AGG | Intronic | ||
| No off target data available for this crispr | |||||