ID: 1062884313

View in Genome Browser
Species Human (GRCh38)
Location 10:1004815-1004837
Sequence CAGTTTAGCCTCAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062884310_1062884313 -1 Left 1062884310 10:1004793-1004815 CCAGGTTTGGGTAGTTTGGAGGC 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1062884313 10:1004815-1004837 CAGTTTAGCCTCAGGGATGAAGG No data
1062884308_1062884313 2 Left 1062884308 10:1004790-1004812 CCACCAGGTTTGGGTAGTTTGGA 0: 1
1: 0
2: 0
3: 8
4: 149
Right 1062884313 10:1004815-1004837 CAGTTTAGCCTCAGGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062884313 Original CRISPR CAGTTTAGCCTCAGGGATGA AGG Intronic
No off target data available for this crispr