ID: 1062888855

View in Genome Browser
Species Human (GRCh38)
Location 10:1040383-1040405
Sequence CTGGATAAAACCCCTGTGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062888855_1062888861 22 Left 1062888855 10:1040383-1040405 CCCACCACAGGGGTTTTATCCAG 0: 1
1: 0
2: 2
3: 9
4: 149
Right 1062888861 10:1040428-1040450 TTTAAGCAACTCTTACCGAGTGG 0: 1
1: 0
2: 0
3: 5
4: 50
1062888855_1062888862 23 Left 1062888855 10:1040383-1040405 CCCACCACAGGGGTTTTATCCAG 0: 1
1: 0
2: 2
3: 9
4: 149
Right 1062888862 10:1040429-1040451 TTAAGCAACTCTTACCGAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062888855 Original CRISPR CTGGATAAAACCCCTGTGGT GGG (reversed) Exonic
900328980 1:2124422-2124444 CAGGGTAGAACCCTTGTGGTGGG + Intronic
901970608 1:12904760-12904782 CTGGAGAAATCTCCAGTGGTAGG - Intronic
902014557 1:13297010-13297032 CTGGAGAAATCTCCAGTGGTAGG + Intergenic
902512168 1:16972461-16972483 CTGGAGAACACCCCTGTGCCTGG + Exonic
909479522 1:76116486-76116508 CTGGATCAATCATCTGTGGTTGG - Intronic
913014418 1:114718204-114718226 CTGCACCAAACCCCTGTGGGGGG + Exonic
913046182 1:115075282-115075304 CAGGAGGAAACCCGTGTGGTTGG - Intronic
914936867 1:151989333-151989355 CTGAATAAAACCGCTGGGGGAGG - Intronic
919963780 1:202500109-202500131 CTGGATAAATACCAAGTGGTGGG - Intronic
919995967 1:202750704-202750726 CTGGTTAAAACCACTGTGGTAGG + Exonic
922710252 1:227823956-227823978 TTGGATAAATACCCAGTGGTGGG + Intronic
922828093 1:228535574-228535596 CTGGTTACAATGCCTGTGGTCGG + Intergenic
923077372 1:230622180-230622202 CTGAATAAATCCCCTGTCCTGGG + Intergenic
923855062 1:237837670-237837692 CTGGATCCATACCCTGTGGTAGG + Intergenic
1062888855 10:1040383-1040405 CTGGATAAAACCCCTGTGGTGGG - Exonic
1072562034 10:96586199-96586221 CCGGATTAAAACCCTGGGGTGGG - Intronic
1073053725 10:100685958-100685980 CTGGATGACACCCCTCTGGCTGG + Intergenic
1076037672 10:127214535-127214557 CTGAATAATACTCCTGTTGTAGG + Intronic
1076185797 10:128447749-128447771 CTGGAGAAAACCCCAAGGGTTGG - Intergenic
1079859670 11:25652320-25652342 TTGTATAAAAGTCCTGTGGTGGG - Intergenic
1080449008 11:32363413-32363435 CTAGACAAATCCCCTGTAGTAGG - Intergenic
1082820423 11:57541158-57541180 CTGGGTAAGACCCCAGTGGGTGG + Intergenic
1083437061 11:62649784-62649806 CTGGATGAAACCCCTGTGGCTGG - Exonic
1083775040 11:64890488-64890510 CTGGAGCACAGCCCTGTGGTTGG - Intergenic
1084209473 11:67614418-67614440 CTAGTTAGAACCCCTGTGGTCGG - Intergenic
1089750276 11:120646795-120646817 CTAAATCAGACCCCTGTGGTTGG - Intronic
1089931918 11:122321425-122321447 CTGGAGAAAAGACCTGAGGTGGG + Intergenic
1090148145 11:124350405-124350427 TTGGATAAATACCCAGTGGTGGG - Intergenic
1091381310 12:63133-63155 CTGGATAAATACCCAGTAGTGGG - Intergenic
1093506423 12:19871891-19871913 CTGGGTAAATCCCCAGTAGTGGG - Intergenic
1098958460 12:76712521-76712543 CTGTATAAAACCAATGTGGGTGG - Intergenic
1099806396 12:87525994-87526016 CAGGCTAGAACCTCTGTGGTAGG - Intergenic
1102793823 12:115671484-115671506 ATGGATGACACCCCTATGGTTGG - Intergenic
1102846432 12:116189463-116189485 CTGCAAGAAACCCCTGTGGGAGG - Intronic
1104307190 12:127620205-127620227 TTGGATAAATGCCCTGTGGTTGG + Intergenic
1104617153 12:130280351-130280373 CTGGTTAAAAGCACTGTTGTTGG + Intergenic
1104809517 12:131611922-131611944 CTGGAAAAATCCCCTGGGGTGGG + Intergenic
1104926319 12:132315863-132315885 CTGCAATAAACCCCTGTGCTGGG + Intronic
1105304422 13:19158840-19158862 CAGAATGAAACCCCTGTTGTTGG - Intergenic
1111659478 13:91191475-91191497 TTGGATAAAGACCCAGTGGTGGG + Intergenic
1115333950 14:32226868-32226890 CTGGATAAAACTCCGGTTGCTGG + Intergenic
1118197106 14:63637532-63637554 GTGGATAAAGACACTGTGGTGGG + Intronic
1118438497 14:65792241-65792263 CTGGGCAAAGCCCCTGAGGTGGG + Intergenic
1119895219 14:78214231-78214253 ATGGACAAAGGCCCTGTGGTAGG - Intergenic
1120383106 14:83808185-83808207 CTGAATACAAATCCTGTGGTTGG - Intergenic
1122424479 14:101597934-101597956 CTGGGTAGATACCCTGTGGTGGG + Intergenic
1122498184 14:102174245-102174267 CTGGGTAGATACCCTGTGGTGGG + Intronic
1125115558 15:36087061-36087083 TTGGATAAATGCCCAGTGGTGGG - Intergenic
1125859600 15:42986734-42986756 CTGAATAAAGCCACTGTGGGTGG - Intronic
1125892712 15:43278101-43278123 CTGGGTGAAAACCCTGGGGTAGG + Intronic
1126285965 15:47010946-47010968 CTGGATAAATACCCAGTAGTGGG - Intergenic
1126883609 15:53125738-53125760 CTGGATACAAGCCCTGCCGTTGG - Intergenic
1128034460 15:64511675-64511697 CTGGATAAAATCTTTGTGGCTGG + Intronic
1132279442 15:100600813-100600835 CTGGATACAACCACTTTGGAAGG - Intronic
1135530970 16:23254344-23254366 ATGGATAAAACCTTTGTGGAGGG + Intergenic
1140177278 16:72675380-72675402 CTGGATATATCCCATATGGTAGG + Intergenic
1152170511 17:78743841-78743863 CTGGTTAAAAGCCGTGTGGTAGG + Intronic
1153259727 18:3211911-3211933 TTGATTAAAACCCCTGGGGTTGG - Intronic
1153514672 18:5892257-5892279 GTGGATAAAGGCCCTGGGGTGGG - Intronic
1155410712 18:25541809-25541831 CTGAGCAAAACTCCTGTGGTAGG + Intergenic
1156010813 18:32495565-32495587 CTGGATAGATACCCAGTGGTGGG + Intergenic
1156372131 18:36480964-36480986 CTGCATAAAAAAACTGTGGTTGG - Intronic
1156614252 18:38764791-38764813 CTGGATAGAAACCCAGTAGTGGG - Intergenic
1159474974 18:68909933-68909955 CAAGATAAAAATCCTGTGGTGGG + Intronic
1163784773 19:19269439-19269461 CTGGGTCAAACCCCTGGGGCTGG + Intronic
1165101209 19:33439659-33439681 CTAGAGGAAACCCCTGTGGTGGG - Intronic
1168279756 19:55298846-55298868 CTGGAGAAAGCCCCTCTGATGGG + Intronic
925637329 2:5952809-5952831 CTGGATACAGCCCCTGTGACTGG + Intergenic
926957516 2:18317759-18317781 CTTGTTAAAAATCCTGTGGTCGG + Intronic
929072934 2:38052020-38052042 TTGGATAAATACCCAGTGGTGGG + Intronic
932932623 2:76060695-76060717 TTGAATTTAACCCCTGTGGTAGG + Intergenic
933346205 2:81088822-81088844 CAGGATAAGACCCATGTGTTTGG + Intergenic
936141343 2:109944642-109944664 CTGGATAGATACCCAGTGGTGGG - Intergenic
936178032 2:110242590-110242612 CTGGATAGATACCCAGTGGTGGG - Intergenic
936203350 2:110426841-110426863 CTGGATAGATACCCAGTGGTGGG + Intronic
937390791 2:121484552-121484574 CTGGATGGAAGCCCTGTGATGGG - Intronic
937552897 2:123116482-123116504 CTGGATAAAGCAAATGTGGTAGG - Intergenic
937776406 2:125781946-125781968 CTGGAACAGACCCCTGTGGGTGG - Intergenic
939136988 2:138308699-138308721 CTGCATAAAATCTTTGTGGTGGG + Intergenic
941444475 2:165583456-165583478 CTGGAAAAGACCCCAGTGGGAGG + Intronic
942486449 2:176444896-176444918 CAGGAGAAAACAGCTGTGGTAGG + Intergenic
943653742 2:190485192-190485214 ATAGATACAAACCCTGTGGTTGG + Intronic
944753738 2:202738149-202738171 CTGGATAAAAGTCCTTTGTTGGG + Intronic
946067950 2:217006268-217006290 CTGGATAACTCCTCTGTGCTAGG + Intergenic
947044392 2:225963896-225963918 TTGGATAAATACCCTGTAGTGGG - Intergenic
948596250 2:239081616-239081638 CTGGATGAAAGCCCTGCTGTTGG + Intronic
1169272780 20:4213392-4213414 CTGTATGAAGCCCATGTGGTAGG + Intergenic
1173173015 20:40742368-40742390 CTAGATACAGCCCCTGTGCTGGG - Intergenic
1173402863 20:42740353-42740375 CTGGATAAAACCCCAGAGGAAGG - Intronic
1176283898 20:64331701-64331723 CTGGATAAATACCCAGTAGTGGG + Intergenic
1176408575 21:6435256-6435278 CTGGCCAAAACCTCTGTGGCTGG - Intergenic
1179684065 21:43043578-43043600 CTGGCCAAAACCTCTGTGGCTGG - Intergenic
1181539007 22:23563245-23563267 CAGGATCAAAACCCTCTGGTCGG - Intergenic
1182112868 22:27735671-27735693 ATGTACAAAGCCCCTGTGGTGGG - Intergenic
1183085020 22:35481382-35481404 CTGGAAGAAACCCGTGTGGCGGG - Intergenic
1183602040 22:38845281-38845303 CTGGACAAAATCCCCGTGGCTGG - Intergenic
949342374 3:3043935-3043957 ATGGATAAAGACCCTGTGTTTGG + Intronic
952011910 3:28909303-28909325 TTGCCTACAACCCCTGTGGTTGG + Intergenic
952222923 3:31342536-31342558 CTGGATAAAACTACTGGTGTGGG - Intergenic
956102622 3:65784414-65784436 CTGGATAAAAAACATGTGGTAGG + Intronic
957713245 3:83891359-83891381 CTGCATGAAACCCCTCTGATAGG + Intergenic
958066823 3:88554434-88554456 CTGGATAGATACCCTGTTGTGGG - Intergenic
959082575 3:101817619-101817641 CAGAACAAAACCCCAGTGGTTGG + Intronic
959760339 3:109955627-109955649 TTGGATAAAAACCCAGTAGTAGG + Intergenic
961657395 3:128450785-128450807 CTGGAGAAGACCACTGTGGCTGG - Intergenic
963818523 3:149861272-149861294 TTGGATAAATACCCAGTGGTGGG - Intronic
965575104 3:170210044-170210066 CTGGTTAAAACCACTGTTGGTGG + Intergenic
967364513 3:188670674-188670696 TTGGATTAAACTCATGTGGTTGG + Intronic
970652164 4:18190909-18190931 CTATATAAAAGCCCTGTGTTAGG + Intergenic
971395057 4:26219649-26219671 CTGTTAAAAACCCCTGAGGTAGG + Intronic
971501132 4:27318954-27318976 GTGGCTAGAGCCCCTGTGGTCGG + Intergenic
976138576 4:81965386-81965408 CTGGATAAATACCCAGTAGTGGG + Intronic
977389986 4:96395958-96395980 TTGGATAAATACCCAGTGGTGGG + Intergenic
981588483 4:146329915-146329937 ATGGATAAAACCAAAGTGGTAGG + Intronic
985834234 5:2258970-2258992 CCGGATAAAAGTTCTGTGGTGGG + Intergenic
986794060 5:11191966-11191988 CTGGTGAAAACGCCTGTGGAAGG - Intronic
987436480 5:17900941-17900963 CTGGGTAGATCCCCTGTAGTGGG + Intergenic
994043256 5:95282570-95282592 CTGGATAGAGCCCCTGTTTTTGG - Intronic
997041117 5:130255877-130255899 TTGGATATACACCCTGTGGTAGG + Intergenic
997085542 5:130793445-130793467 TTGGATAAATACCCAGTGGTGGG - Intergenic
998174223 5:139891645-139891667 CTGGATAAAGACCCTAAGGTGGG + Intronic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1005734283 6:28731232-28731254 CTGGTTAAAACCTCTGTCCTGGG - Intergenic
1007529827 6:42532226-42532248 CTGGATAAAACATTTGTGGAAGG - Intergenic
1018640024 6:165897322-165897344 CTGGATGAAACACCTGGGGAGGG + Intronic
1018785537 6:167105150-167105172 CTGGAAGAAGCCCATGTGGTCGG + Intergenic
1019000812 6:168749593-168749615 CTGGGTAAAAACCCAGTAGTGGG + Intergenic
1019847346 7:3518784-3518806 CTGGATAAATGCCCAGTAGTGGG - Intronic
1021234852 7:18130295-18130317 CTGTATAAAGGCCCTGAGGTAGG + Intronic
1025851712 7:65249867-65249889 CTTGATACAACCCCAGAGGTGGG + Intergenic
1027981093 7:85223367-85223389 CTGGATAAATACCCAGTAGTGGG - Intergenic
1031680216 7:124664171-124664193 GTGGCTAAAATCCTTGTGGTAGG + Intergenic
1031906834 7:127469723-127469745 TTGGATAAATCCCCAGTAGTGGG - Intergenic
1034401089 7:150862014-150862036 GGGGATAAACCCCCTGAGGTTGG - Intergenic
1034637208 7:152576865-152576887 CTGGCTGAGACCCCTGTGCTGGG - Intergenic
1038836675 8:31132668-31132690 TTGGATAAAACCCGTGTGTATGG + Intronic
1039430763 8:37523363-37523385 CCGGATAGAAACCCTGTGGTGGG + Intergenic
1041840863 8:62269156-62269178 CTCAATAAAACCCCTGTGCATGG + Intronic
1045008982 8:97941469-97941491 CTTAATAATACCCATGTGGTGGG - Intronic
1047801266 8:128312994-128313016 CGGGAGAAAACTCCTGTGATGGG + Intergenic
1049267965 8:141679540-141679562 CTGGAATGAACCCCTGTGGGAGG + Intergenic
1051823154 9:21191833-21191855 CTGGATGAAACCCCTTTCCTAGG - Intergenic
1053156252 9:35781775-35781797 CTGGATTAAACACCAGTGTTAGG - Intergenic
1053651828 9:40177092-40177114 CAGAATAAAAACCCTGGGGTGGG - Intergenic
1053902220 9:42806405-42806427 CAGAATAAAAACCCTGGGGTGGG - Intergenic
1054532757 9:66199115-66199137 CAGAATAAAAACCCTGGGGTGGG + Intergenic
1056256245 9:84802452-84802474 CTGTGTAAAACCACTGAGGTTGG + Intronic
1057798888 9:98177270-98177292 CTGGAGATAGCCCCTGTGCTGGG + Intronic
1058970385 9:110076961-110076983 ATGTATACCACCCCTGTGGTAGG + Intronic
1059210549 9:112510918-112510940 CAGTATAAAATCCCTGAGGTGGG + Intronic
1060991167 9:127850031-127850053 CTGGCTTCAACCCCTGTGGCAGG - Intronic
1203455460 Un_GL000219v1:163124-163146 CTGCAGAACACCCCTGTTGTGGG - Intergenic
1186283013 X:8014500-8014522 CTGGATCCATCCTCTGTGGTGGG + Intergenic
1189612571 X:42752852-42752874 CTTGATAATACATCTGTGGTTGG + Intergenic
1190628012 X:52355229-52355251 CTGGAAACAATCCCTTTGGTAGG + Intergenic
1193193322 X:78599914-78599936 CTGGATAGATACCCTGTAGTGGG - Intergenic
1193390805 X:80926626-80926648 CTGGATAAATACCCAGTAGTGGG - Intergenic
1197162815 X:123343239-123343261 CTGGATAAAAACCTGGTGGTGGG - Intronic
1198942833 X:141976736-141976758 CTGGATAAATACCCAGTAGTGGG + Intergenic
1202299429 Y:23395956-23395978 CTGGATAAATACCCAGTAGTGGG - Intergenic
1202571380 Y:26274642-26274664 CTGGATAAATACCCAGTAGTGGG + Intergenic