ID: 1062889071

View in Genome Browser
Species Human (GRCh38)
Location 10:1043517-1043539
Sequence CCACATGCATAGTCTCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062889071 Original CRISPR CCACATGCATAGTCTCTGCA TGG Intronic
903886170 1:26542342-26542364 CCACCCGCAGAGACTCTGCAAGG + Intronic
904770526 1:32878679-32878701 CCCCATGCATAGTCTCAGGGAGG + Intergenic
905184041 1:36183533-36183555 CCACATGCACAGGCTGTGGATGG + Intergenic
909551967 1:76907972-76907994 CCACCTGCAGAATCTCTGGAAGG + Intronic
914948236 1:152085925-152085947 CAACATGGAGAGTCTGTGCAAGG - Exonic
915153708 1:153856885-153856907 CCATATCCATAGTATCTGGAGGG - Intronic
916854726 1:168737832-168737854 GCACGTGCATATACTCTGCAGGG - Intergenic
918075334 1:181166676-181166698 CCACATGCAGAGCCACTACAGGG - Intergenic
918718118 1:187817989-187818011 GCCCATGCAGAGTCTCTGCTGGG - Intergenic
922869069 1:228885423-228885445 CCTCAAGCATAGTCTTTGAATGG + Intergenic
923714383 1:236412406-236412428 CCTCATGCAAAGTCAGTGCAAGG + Intronic
923914971 1:238491893-238491915 CCACATCCATGGGCTCTGCAAGG + Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1073906438 10:108285943-108285965 CCACATGCATAGATTCTACAGGG - Intergenic
1074392485 10:113069681-113069703 CTACATACACAGTCTCTGAATGG - Intronic
1074465719 10:113679742-113679764 CCGCACGCATAGTCCCTGGAGGG - Intronic
1081077355 11:38693508-38693530 ACACATGCATTGGCTGTGCAAGG - Intergenic
1085239012 11:75036437-75036459 CCACATGTATGGTCTGTGCTGGG - Intergenic
1087183956 11:95166712-95166734 ACACATACACAGTCTCAGCAAGG - Exonic
1088791448 11:113230781-113230803 CCACATGCCTAGACTCTTCCTGG + Intronic
1093442816 12:19219166-19219188 TCACATACATGGGCTCTGCAAGG + Intronic
1095180343 12:39140872-39140894 TGACACGCACAGTCTCTGCATGG - Intergenic
1095871175 12:47029927-47029949 CCACATGGTTAGTTTCTTCATGG + Intergenic
1099533924 12:83822759-83822781 GCACATTCATACTATCTGCAAGG + Intergenic
1099905121 12:88762000-88762022 CCTCATGGAGAGTCTCTGCTAGG - Intergenic
1102709626 12:114914736-114914758 CTACATGCCTTGTATCTGCAGGG + Intergenic
1103585218 12:121948156-121948178 TCACTTCCATAGTTTCTGCAGGG + Intronic
1106301636 13:28471573-28471595 ACACATGCATAGTCATAGCATGG + Intronic
1107094507 13:36520380-36520402 ACACATGCAAATTCTCTACACGG - Intergenic
1110232213 13:73178853-73178875 CCACATGTGTGGTGTCTGCAGGG - Intergenic
1110362469 13:74642990-74643012 ACACATGCATATCCTCTCCAAGG + Intergenic
1117875029 14:60243433-60243455 TTACATGCATTGTGTCTGCATGG - Intergenic
1118085599 14:62412434-62412456 CCAGATACATGGTCTCTGAAAGG + Intergenic
1118966850 14:70595092-70595114 CAACATCCATGGGCTCTGCAAGG + Intronic
1123895896 15:24829508-24829530 CCCCATGCCCAGTCCCTGCATGG - Intronic
1125503742 15:40254839-40254861 CCACATGGATAGACTGTGCTAGG - Intronic
1127132663 15:55883281-55883303 CCACAGGCAGAGTCTCTCCGTGG - Intronic
1127809106 15:62548046-62548068 CCACAAGCATAGTCTCGGGCTGG - Intronic
1128554679 15:68623399-68623421 CCACATGCATGGACACTGCCAGG - Intronic
1129830379 15:78665700-78665722 TCACATGCATAATGTCTTCAAGG - Intronic
1135289584 16:21223850-21223872 CTATATGCATGGTCTCTCCATGG - Intergenic
1136392788 16:29975793-29975815 CCATATGCTGAGTGTCTGCATGG + Intronic
1136597322 16:31260290-31260312 CCACATTCATGGACTGTGCAAGG + Intronic
1137533934 16:49302998-49303020 GCACATGCTAAGTCTCTGCCTGG + Intergenic
1138056662 16:53841540-53841562 CCAAGTTCATGGTCTCTGCAAGG - Intronic
1138402074 16:56754587-56754609 CCCCATGCTTTGGCTCTGCAGGG + Intronic
1143721173 17:8810949-8810971 CCCCATGCAGAGTCCCTGCTGGG - Intronic
1144022927 17:11252766-11252788 CCACATGCCCTGTCGCTGCAGGG - Intronic
1144166705 17:12618626-12618648 ACACATGCATTTTCTCTGTAAGG - Intergenic
1150289661 17:63973947-63973969 CCACAGGAATAGGCTCTGGAGGG - Intergenic
1159353060 18:67299888-67299910 CCACATGGATTGTCCCTACATGG - Intergenic
1160849226 19:1182094-1182116 GCACATGCAAAGTCTCAGCGGGG + Intronic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
925031257 2:651421-651443 CCTCATGCATGGGCTCTGCATGG + Intergenic
925152629 2:1625612-1625634 CCACATTCCTGGCCTCTGCAAGG + Intergenic
930617180 2:53605845-53605867 TCACATCCATATTCTCTGGAAGG - Intronic
930721213 2:54640017-54640039 CAGCATGTATAGTCTCTGCATGG + Intronic
931370744 2:61660462-61660484 CCACATGCCAAGTCTCTTCTAGG - Intergenic
934528228 2:95066295-95066317 ACACATGTATTTTCTCTGCAAGG + Intergenic
935395132 2:102599651-102599673 CCACAGGCATAGTCTTCTCATGG + Intergenic
935927795 2:108089213-108089235 CCTCATGGATAGCCTCTGCTAGG + Intergenic
942328053 2:174792092-174792114 CCACCAGCATAGCCTCTGCTGGG - Intergenic
943998081 2:194797207-194797229 CCTCATGGATAGCCTCTGCCAGG + Intergenic
946868967 2:224068759-224068781 CCACAGGCATAGCCTTTGCCAGG + Intergenic
947702359 2:232245023-232245045 CCACATGGATAATTTCTTCAAGG - Intronic
1169529890 20:6473782-6473804 CCAAATGCACATTCCCTGCATGG + Intergenic
1170643862 20:18179358-18179380 CCTCATGGATAATCTCTGCTAGG - Intronic
1172950096 20:38717700-38717722 CCAAATGCTTATTCTCTGCTAGG - Intergenic
1174349582 20:49957282-49957304 CGACATCCATGGGCTCTGCAAGG + Intergenic
1175670856 20:60901663-60901685 TCCCATGCACAGTCTATGCAAGG + Intergenic
1175670859 20:60901665-60901687 CCCCTTGCATAGACTGTGCATGG - Intergenic
1175966963 20:62664627-62664649 CCACAGGCATAGGCTCAGCCTGG + Intronic
1177965127 21:27718298-27718320 ACAAATGCATAGTTTCTGCAGGG - Intergenic
1178002807 21:28182570-28182592 CCTCATGGAGAGTCTCTGCTAGG + Intergenic
1178099570 21:29253114-29253136 CCACATGGAGAATCTCTGCCAGG - Intronic
1179408042 21:41141346-41141368 CCACAGGCAGAGGCTGTGCAAGG + Intergenic
1179510403 21:41869200-41869222 TCACAAGCATAGTCTGTGAAAGG - Intronic
1179713183 21:43274650-43274672 CCACATGCAGAGACTCTGAGTGG - Intergenic
1179960730 21:44765863-44765885 CAACATGCATGGCCACTGCAGGG + Intergenic
1180181299 21:46119767-46119789 CCACACGCCTGTTCTCTGCAGGG + Exonic
1180887577 22:19258061-19258083 CGACATCCATGGGCTCTGCAAGG + Intronic
1181964890 22:26649537-26649559 GCACATGCTTGGTCTGTGCAAGG + Intergenic
1182024670 22:27108813-27108835 CCACAAGCATAGTCTCCGCCAGG + Intergenic
1182096905 22:27631452-27631474 CCACATGCATACTCCCTTCCAGG - Intergenic
1182473487 22:30562714-30562736 CCTCATCCACATTCTCTGCACGG - Intronic
1182966255 22:34524066-34524088 TCACATGCATAGGGACTGCATGG - Intergenic
1183696626 22:39427346-39427368 CCACATGCCTAATCTCTTCCAGG - Intronic
1184459211 22:44627736-44627758 GCACATGCATGGGCTCTGCGGGG - Intergenic
1185328434 22:50239476-50239498 CGAAATGCATATTCTCTGCCTGG + Intronic
949621443 3:5817043-5817065 CAACAGGCAGAGTCTGTGCATGG + Intergenic
951063197 3:18234453-18234475 AGACATCCAAAGTCTCTGCACGG - Intronic
951275432 3:20679432-20679454 GCAAATGCAAAATCTCTGCATGG - Intergenic
951769120 3:26235357-26235379 TCTCATTCATTGTCTCTGCAGGG - Intergenic
958600355 3:96289028-96289050 TCACATGCAGAATCTCTGCTAGG + Intergenic
969095976 4:4733251-4733273 CCACTTTCAGAGCCTCTGCAGGG + Intergenic
969134150 4:5016563-5016585 CCACATAGATAGACTCTGCCAGG - Intronic
969265875 4:6063824-6063846 CCACATCCCGAGTCTCTGAATGG - Intronic
969847648 4:9931872-9931894 CCACATGGAGAGTGACTGCAGGG + Intronic
973240265 4:47949105-47949127 CCACCTGCATAGCCACTGTATGG - Intronic
974786996 4:66631344-66631366 CAACATTCATAGTCTGTGCAGGG - Intergenic
975681105 4:76877134-76877156 CCACCTGCATCGTCCTTGCAGGG - Intergenic
991963066 5:72064985-72065007 CCACATGCCTAGTCTCCCCAGGG + Intergenic
994719807 5:103367351-103367373 CCCCATGCACAGTGTCAGCAGGG + Intergenic
997088313 5:130826924-130826946 CCACATGGAGAGCCTCTGCTAGG - Intergenic
1000436460 5:161216511-161216533 CCAACTTCATAGTCTTTGCAAGG - Intergenic
1001721878 5:173863571-173863593 ACACATGCAGAGGCTCTGCTGGG + Intergenic
1006067550 6:31472937-31472959 ACACATGCACAGTGTGTGCACGG + Intergenic
1008499839 6:52169987-52170009 CCTCATGCAGAGTCTCTACTGGG - Intergenic
1009901672 6:69814765-69814787 CCACATGCATACTTTCTAGATGG + Intergenic
1009963182 6:70549476-70549498 CCACATCCACAGTATCTCCAAGG - Intronic
1010602127 6:77842122-77842144 CCAAATTCATAGTCTTTTCAAGG + Intronic
1012630828 6:101464896-101464918 CCATATACTTAGTCTCTGCCAGG - Intronic
1012791337 6:103701236-103701258 CCACATGTTTAGTCTCTGCATGG + Intergenic
1014945129 6:127488211-127488233 CCACTTCCATAGTCTCTTCAGGG + Intronic
1015147127 6:129999830-129999852 TGACATGCATAATCTCTGTATGG - Intergenic
1015331343 6:131982929-131982951 TCACACTCATAGTCTCTGCTTGG + Intergenic
1015827646 6:137331792-137331814 CCAAATGCATATTGTATGCAGGG - Intergenic
1018456727 6:163960258-163960280 CCAGATTCTTTGTCTCTGCAAGG + Intergenic
1021958986 7:25853544-25853566 CCAGATCCTTAGTGTCTGCAGGG - Intergenic
1024236282 7:47401629-47401651 CCACATGCCAAGCATCTGCAAGG - Intronic
1024601181 7:50982896-50982918 CCACCAGCACAGTCCCTGCACGG - Intergenic
1028432813 7:90767113-90767135 CCCCATGCACAGTGTCAGCAGGG + Intronic
1030459072 7:109808175-109808197 CCTCATGGATAATCTCTGCTAGG + Intergenic
1031722622 7:125194816-125194838 TCACAAGCATAGTGTCTGAAAGG + Intergenic
1033496789 7:141906874-141906896 ACACATGCATTTTCTCTGTAAGG + Intergenic
1034718348 7:153264341-153264363 CCACATGGAGAATCTCTGCTAGG - Intergenic
1039866768 8:41511776-41511798 CAACATCCATGGGCTCTGCAAGG + Intergenic
1041167566 8:55104162-55104184 CCACTTGAACAGTCACTGCATGG + Intronic
1042733433 8:71962248-71962270 CCACATTCTGAGTCACTGCAGGG - Intronic
1045297149 8:100882054-100882076 CCCCATGCACAGTGTCAGCAGGG + Intergenic
1048026430 8:130591484-130591506 CTACATGCATGGTCTGTGCCAGG - Intergenic
1051687126 9:19669553-19669575 CTAAAAGCAAAGTCTCTGCAGGG + Intronic
1052613002 9:30800191-30800213 CGACATCCATGGGCTCTGCAAGG - Intergenic
1054766035 9:69043338-69043360 ACACATGCATTTTCTCTGTAAGG - Intronic
1055078462 9:72242222-72242244 CCAAATGCATGGTCTTGGCAGGG - Intronic
1055848665 9:80598224-80598246 GCACATGCACATTCTCTGCATGG + Intergenic
1056568360 9:87794699-87794721 CAACATGAATTGTTTCTGCAGGG + Intergenic
1057700967 9:97362783-97362805 CCACATGCATATTTTATGGAAGG + Intronic
1185721108 X:2382171-2382193 CCACAAGCACAGTCTTTGCTTGG + Intronic
1186082540 X:5948976-5948998 CACCATGCATAGCCTCTCCATGG + Intronic
1188835775 X:34952640-34952662 CCATATGCTTATTCACTGCATGG - Intergenic
1191031247 X:55975264-55975286 CCAAATGCATTCTCTCTTCAGGG - Intergenic
1191586421 X:62832112-62832134 CCAAAAGCACAGTCTCTGAAAGG + Intergenic
1193485209 X:82078729-82078751 CCTCATGGAGAATCTCTGCAAGG - Intergenic