ID: 1062893110

View in Genome Browser
Species Human (GRCh38)
Location 10:1080486-1080508
Sequence CATGATGGCTCAAGAGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062893110 Original CRISPR CATGATGGCTCAAGAGCCAG TGG (reversed) Intronic
902205535 1:14865633-14865655 CAGGATGGCTGGAGAGCAAGGGG - Intronic
902654696 1:17859377-17859399 CTGGATGGGTAAAGAGCCAGTGG - Intergenic
903049634 1:20590986-20591008 CATCGTGCCTCCAGAGCCAGGGG + Intronic
906503960 1:46363471-46363493 GATGATGACTCTAGAGGCAGGGG - Intronic
908532317 1:65045520-65045542 CATGGTGGCTCTGGAGTCAGGGG + Intergenic
909218651 1:72925885-72925907 CATGGTGGCTGAAAATCCAGTGG + Intergenic
910050234 1:82964646-82964668 AATGATGTCTCAACAGCTAGGGG - Intergenic
915396700 1:155590558-155590580 CTGGATGGCTCTAGTGCCAGCGG + Intergenic
916558112 1:165910429-165910451 CTGGATGGCTCTGGAGCCAGGGG - Intronic
918108876 1:181438270-181438292 CATAATGGCTCTAGAAGCAGAGG + Intronic
918752764 1:188293013-188293035 GATGTTGGCTCAAGGGCCTGGGG - Intergenic
920724209 1:208418449-208418471 AATGGTGGCTAAAGAGGCAGAGG + Intergenic
1062893110 10:1080486-1080508 CATGATGGCTCAAGAGCCAGTGG - Intronic
1062901494 10:1150178-1150200 CATGGTGGCAGAAGAGGCAGAGG - Intergenic
1065435847 10:25703139-25703161 CATGAGGGACCCAGAGCCAGAGG + Intergenic
1068612013 10:59070429-59070451 TCTGAAGGCTCAAGAACCAGGGG + Intergenic
1068777272 10:60881516-60881538 CGTGATAGCGCAAGAGCCTGGGG + Intronic
1068862843 10:61865456-61865478 CATTCTGACTCCAGAGCCAGAGG - Intergenic
1069128619 10:64670239-64670261 CATGGTGGCTCAGGAGGCTGAGG + Intergenic
1070365999 10:75737749-75737771 CATGATGGCTCCAGACTAAGGGG - Intronic
1070481936 10:76891205-76891227 CATCCTGGCTTCAGAGCCAGTGG - Intronic
1071238437 10:83677057-83677079 CATGGTTGCTCAGGAGCCAAAGG + Intergenic
1075141330 10:119839282-119839304 AATGGTGGCTCAAGAGCTGGAGG - Intronic
1075611555 10:123858922-123858944 CATGACGGAGGAAGAGCCAGCGG + Intronic
1078756675 11:14217470-14217492 AATTATCCCTCAAGAGCCAGTGG - Intronic
1082821977 11:57550191-57550213 CATGGAGGCACCAGAGCCAGGGG + Exonic
1083150600 11:60789568-60789590 CAGGCTGGCTCCAGAGCCTGGGG - Intronic
1085321946 11:75580336-75580358 CAAGATGGCTCAAGTGTCTGCGG + Intergenic
1089587212 11:119517875-119517897 CATGATGGCTGAAGAGCTCAGGG - Intergenic
1090118663 11:124001420-124001442 CAAAATGTCACAAGAGCCAGAGG + Intergenic
1093619977 12:21277350-21277372 CATGCTGGCTAAAGAGCCCTTGG + Intronic
1095605318 12:44060529-44060551 CATGAGAGCTCAGGAGCCTGTGG + Intronic
1098066777 12:66627029-66627051 GATGATGGCCCAGCAGCCAGTGG - Intronic
1099047182 12:77736485-77736507 CATGCTGTCTCAAGGGCCAGTGG - Intergenic
1103149253 12:118622782-118622804 CATGGTCGGTCAAGAGGCAGAGG - Intergenic
1104141066 12:125985955-125985977 TATGATGGCGCTAGAGCCAGTGG + Intergenic
1105028642 12:132867360-132867382 CAGGCTGGCTCATGAGACAGAGG + Intronic
1110272431 13:73605619-73605641 CATGAGGCCTCCAGCGCCAGTGG + Intergenic
1111564028 13:89991457-89991479 AATGAGAGCTCAAAAGCCAGCGG - Intergenic
1113579639 13:111420045-111420067 CAGGATGCCTCCTGAGCCAGAGG + Intergenic
1118990554 14:70793350-70793372 TAAGATGGATCAAGGGCCAGGGG + Intronic
1119609576 14:76050300-76050322 AATGAAGGCTCCAAAGCCAGTGG - Intronic
1123919901 15:25062873-25062895 CAGGAGGGCTGAAGAGCCATTGG - Intergenic
1124375388 15:29126113-29126135 CTTGATGGCCCCTGAGCCAGGGG - Intronic
1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG + Exonic
1128822113 15:70666443-70666465 CATGAAGAGTCAAAAGCCAGTGG - Intronic
1129088537 15:73123485-73123507 CATGGTGGCTCTAGAGACAATGG + Intronic
1129451541 15:75653794-75653816 GATGATGGCTCAGAACCCAGAGG - Intronic
1129536822 15:76320055-76320077 TGTGATGGCTAAAGAGGCAGAGG - Intergenic
1131592713 15:93767190-93767212 CATGCTGCCTCAAGTGACAGTGG + Intergenic
1132243437 15:100277230-100277252 ACTGGTGGCTCAAGAGCCCGGGG - Intronic
1132328645 15:100994881-100994903 AAGGATGACTCAGGAGCCAGAGG + Intronic
1133031935 16:3015316-3015338 CTGGATGGCTCTAGCGCCAGCGG + Exonic
1133893168 16:9900818-9900840 CCAGCTGGCACAAGAGCCAGTGG + Intronic
1133977908 16:10613138-10613160 CCTGAGGGCTCAAGAGTGAGAGG - Intergenic
1134204853 16:12228840-12228862 CATGGCGAGTCAAGAGCCAGAGG + Intronic
1137510193 16:49092838-49092860 CAGGGTGGGTCAAGAGGCAGAGG + Intergenic
1137758411 16:50920579-50920601 CAGGTGGGGTCAAGAGCCAGGGG - Intergenic
1138441786 16:57039805-57039827 CATGTTTGCCCAGGAGCCAGAGG + Exonic
1138478944 16:57288949-57288971 CATGGTGGCTCAAGGACCTGTGG - Intergenic
1140732810 16:77871666-77871688 AATGATGGCCCCAGAGTCAGAGG + Intronic
1144275892 17:13667829-13667851 CATGGTGGCTCCACTGCCAGGGG - Intergenic
1144458200 17:15436193-15436215 CATAAAAGCACAAGAGCCAGAGG + Exonic
1145976892 17:28988981-28989003 CAGGATGGCTAAGGAGGCAGTGG - Intronic
1146819937 17:35976881-35976903 CTTAATGGGTCAAGACCCAGAGG + Exonic
1147358803 17:39918417-39918439 CATGATGGGGCCAGAGACAGAGG - Intronic
1147548408 17:41420887-41420909 CATGCTGGCTCCATGGCCAGAGG + Exonic
1152698208 17:81806627-81806649 CATGTTGACTCTAGAGCCACTGG - Intronic
1156080705 18:33331356-33331378 CAGGATGGCTGAAGAGCAAAAGG - Intronic
1157884667 18:51355025-51355047 GATGATGGCTGCAGAGACAGAGG + Intergenic
1158876349 18:61738031-61738053 CATGAGGGCTGATGGGCCAGAGG - Intergenic
1159475663 18:68917337-68917359 GATGATGGCTGATGAGCCTGGGG + Intronic
1163251228 19:16127532-16127554 CATGGTGGCACAAGGGGCAGAGG + Intronic
1167435654 19:49477007-49477029 CATGGTGGCTCAGGAGGCTGAGG + Intronic
1168672080 19:58248203-58248225 AATGATGCCTCAAGGGCAAGGGG - Intronic
926318161 2:11726625-11726647 CATGATTGCTAAAGTCCCAGAGG - Intronic
927158428 2:20235927-20235949 TGAGATGGTTCAAGAGCCAGGGG + Intergenic
927719251 2:25372552-25372574 CACGTGGGCTGAAGAGCCAGGGG - Intergenic
938343914 2:130553309-130553331 CCTGAAGGCTCAGAAGCCAGGGG - Intergenic
938345919 2:130567413-130567435 CCTGAAGGCTCAGAAGCCAGGGG + Intergenic
938419850 2:131136341-131136363 CATGGTGGCTCAGGAGGCTGAGG - Intronic
938587823 2:132708364-132708386 CAAGCTGACTAAAGAGCCAGTGG + Intronic
939892968 2:147759449-147759471 CTTGAAGGCTCTAGAGACAGTGG + Intergenic
943479314 2:188397683-188397705 CATGAGAGATCTAGAGCCAGAGG - Intronic
943777960 2:191787905-191787927 CATGATGGCTAGAGAGAAAGGGG - Intergenic
946623489 2:221585142-221585164 CATGATGGTTACAGAGCCTGGGG - Intergenic
948602786 2:239116769-239116791 CATGAGGGATGCAGAGCCAGCGG - Intronic
1169054505 20:2609583-2609605 CATGAGAGCTGAAGAGGCAGTGG + Intronic
1172511890 20:35506478-35506500 CAAGTTGGCTCAAGAGAGAGAGG + Intronic
1175901316 20:62360968-62360990 CAGGGTGGCTGCAGAGCCAGTGG - Intronic
1178491471 21:33055357-33055379 CATGATTTCTCAAGACCCTGAGG + Intergenic
1178704659 21:34863412-34863434 CATGAGTGCTCAACTGCCAGAGG - Intronic
1179721870 21:43320879-43320901 CATGGTGGCACAGGAGCCATTGG - Intergenic
1180228440 21:46412173-46412195 CATGGTGGCTCATGACACAGCGG + Intronic
1183676792 22:39303478-39303500 CATGATGGCCTCAGGGCCAGTGG + Intergenic
950661209 3:14468163-14468185 CTTCATGGCACAAGAGCAAGGGG + Exonic
953002587 3:38949283-38949305 CATGACTGCTCTAGAGCCTGAGG - Intronic
954960212 3:54557981-54558003 CAGAATGGCTCCAGGGCCAGTGG - Intronic
955353877 3:58214562-58214584 CCTGATGGGACAAGAGTCAGTGG + Intronic
957797000 3:85022077-85022099 CAAAATGGCTTAAGAGCCAGGGG + Intronic
958075065 3:88666096-88666118 CATGATGACCCAAGAACCAGAGG + Intergenic
960008168 3:112803389-112803411 CATTCTGGCTCAAAATCCAGAGG - Intronic
964964975 3:162481432-162481454 CATGTTCACTCAAGAGCCAAGGG + Intergenic
965735676 3:171817785-171817807 CTTGAAGGCTGAAGAACCAGGGG + Intergenic
965816410 3:172641381-172641403 CATGCTGGCTCAAGGGTCTGGGG - Intronic
967757709 3:193188824-193188846 CCTGATGGCTTAAGAAGCAGAGG - Intergenic
967823711 3:193861959-193861981 CATGCAGGCTCCAGAGCCAGAGG - Intergenic
972412862 4:38810573-38810595 CATGATGGGTCCTGAGCCAGGGG + Intronic
973348581 4:49083225-49083247 CAAGATGACTGAAGAGCCACTGG + Intergenic
974025486 4:56729764-56729786 CATGATGGCACAAGTGCATGTGG + Intergenic
976048761 4:80984793-80984815 CATGATGGGTAAAGGGCCAATGG + Intergenic
980137524 4:128873058-128873080 CAAGCTGGCTCAAGAGCCAGTGG - Exonic
980646901 4:135653670-135653692 CATGATGGTTACAGAGCCCGTGG + Intergenic
985872122 5:2565277-2565299 CATGACGGCCCCAAAGCCAGGGG - Intergenic
986064295 5:4220714-4220736 CTGGATGCCTCAAGACCCAGAGG - Intergenic
988195269 5:27997056-27997078 CATGATGGATCAAGTGACAGTGG + Intergenic
989504799 5:42215335-42215357 CAAGCTGGCTTAAGAGCCACTGG - Intergenic
989842818 5:46101630-46101652 CTTGGTGGCTACAGAGCCAGTGG + Intergenic
992157046 5:73965891-73965913 CTTGTTGGCTGAAGAGTCAGAGG - Intergenic
992338826 5:75800731-75800753 TATGGTGGCTCAAGATCCACTGG - Intergenic
995547826 5:113250446-113250468 GATGATGACTCAAGAAACAGAGG - Intronic
997756836 5:136407369-136407391 CAGGATGGCAAAAGAGCCAAGGG + Intergenic
998181877 5:139951721-139951743 CATGGTTGGTCAAGAGCCTGGGG - Intronic
1003261231 6:4518148-4518170 AAAGGTGGCTGAAGAGCCAGGGG + Intergenic
1006127291 6:31847570-31847592 CTTGGTGGCTCAGGAGGCAGAGG - Intergenic
1007016751 6:38475909-38475931 CACGATGGCTCTAGATTCAGTGG + Intronic
1007206606 6:40157554-40157576 AATGATGGCTCAAGAGACTTAGG + Intergenic
1008632414 6:53375175-53375197 CATGATGGCTGATGGGCTAGAGG + Intergenic
1010568135 6:77442974-77442996 CCTGAAAGCTCAAGAACCAGGGG + Intergenic
1012423736 6:99092458-99092480 CATGATGGCTTCAGAGTCAGGGG - Intergenic
1013538033 6:111081378-111081400 CAGGATTGCTCAAAAGCCATAGG - Intergenic
1013940441 6:115654760-115654782 CAAGAAGGCTCAGGAGGCAGAGG - Intergenic
1014552196 6:122801896-122801918 AATGATGTGTCAAGAGCCAGTGG - Intronic
1015096647 6:129422411-129422433 GATGAAGGTGCAAGAGCCAGTGG + Intronic
1018126941 6:160691108-160691130 CATCACGGCTGAAGAGTCAGTGG - Intergenic
1018478057 6:164162358-164162380 TCTGATGGCTCAAGACCCAAAGG + Intergenic
1023238412 7:38115537-38115559 CATGATGCTTCAGCAGCCAGAGG - Intergenic
1025095201 7:56091072-56091094 CATGATGGCTCTCGGGCCTGTGG + Intronic
1029679581 7:102099060-102099082 GATGATGTGTGAAGAGCCAGAGG + Intronic
1030399127 7:109026642-109026664 CCTGATGGATAAGGAGCCAGAGG - Intergenic
1034385093 7:150734407-150734429 GATGATGGATGAAGAGACAGAGG + Intronic
1035968499 8:4221534-4221556 CAGGAAGGCTCAAGAGCAGGAGG + Intronic
1037968270 8:23150482-23150504 CCTGATTGCTCAGGAGCCTGTGG - Intronic
1038856234 8:31336013-31336035 CCTGAAGGCTCAAGAGCCCCTGG - Intergenic
1041030361 8:53730023-53730045 CATGATTGCTCTAGAGGCATAGG - Intronic
1042068309 8:64902979-64903001 TGTGAAGGCCCAAGAGCCAGAGG - Intergenic
1043868105 8:85398773-85398795 CAGGATAGCTCAAGTGACAGGGG - Intronic
1047794597 8:128241617-128241639 CATGATGGTTCAAAAAGCAGAGG + Intergenic
1048846273 8:138606221-138606243 CATCATGGTTTAAGAGACAGTGG - Intronic
1049526648 8:143130167-143130189 CGTGATGGCCCTAGAGCAAGAGG + Intergenic
1049661920 8:143823365-143823387 AAAGAGGGCCCAAGAGCCAGAGG + Intronic
1049668030 8:143856837-143856859 CATTCTGGATGAAGAGCCAGTGG - Intergenic
1050591303 9:7163112-7163134 CATGATGGCTCCAGAGAGAAAGG + Intergenic
1051008505 9:12380703-12380725 GATGATGGCCCAAGAGCCCTTGG + Intergenic
1056885301 9:90436843-90436865 CAGGAGGGCTCAGGAGCCACTGG + Intergenic
1057210877 9:93200403-93200425 CATGTTCCCTCAAGAGCCAGCGG + Intronic
1057346197 9:94252879-94252901 CCTGATGGCCCAAGAATCAGGGG - Intergenic
1057605608 9:96496165-96496187 GCTGATGGCTCAATACCCAGTGG + Intronic
1058871807 9:109208308-109208330 CATCATGGGGCAAGAGCCAGTGG + Intronic
1060167873 9:121434555-121434577 CATGCTGAATCAACAGCCAGAGG + Intergenic
1060419014 9:123454291-123454313 CTTGATGTGTCAGGAGCCAGGGG - Intronic
1187410662 X:19048122-19048144 CTGGAGGGATCAAGAGCCAGGGG - Intronic
1190237921 X:48631646-48631668 CAGGTTGGCTACAGAGCCAGTGG - Intergenic
1194425957 X:93738799-93738821 AATCATTGCTCAAGAGCTAGTGG + Intergenic
1194882809 X:99274470-99274492 CAAGCTGACTCAAGAGCCACTGG + Intergenic
1197953182 X:131919353-131919375 CAAGATGACTGAAGAGCCATTGG + Intergenic
1200037727 X:153344276-153344298 CATGCTGGGGCAAGAGACAGAGG - Intronic