ID: 1062894951

View in Genome Browser
Species Human (GRCh38)
Location 10:1096343-1096365
Sequence CCTTCAACACTGAACTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062894951_1062894966 12 Left 1062894951 10:1096343-1096365 CCCCCCAAGTTCAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1062894966 10:1096378-1096400 TATGGTTGAATTTGGAGATTGGG 0: 1
1: 0
2: 5
3: 59
4: 596
1062894951_1062894965 11 Left 1062894951 10:1096343-1096365 CCCCCCAAGTTCAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1062894965 10:1096377-1096399 GTATGGTTGAATTTGGAGATTGG 0: 1
1: 0
2: 16
3: 129
4: 638
1062894951_1062894958 -6 Left 1062894951 10:1096343-1096365 CCCCCCAAGTTCAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1062894958 10:1096360-1096382 TGAAGGCCTCACCCCCGGTATGG 0: 1
1: 0
2: 0
3: 12
4: 96
1062894951_1062894960 4 Left 1062894951 10:1096343-1096365 CCCCCCAAGTTCAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1062894960 10:1096370-1096392 ACCCCCGGTATGGTTGAATTTGG 0: 1
1: 0
2: 0
3: 10
4: 105
1062894951_1062894967 21 Left 1062894951 10:1096343-1096365 CCCCCCAAGTTCAGTGTTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1062894967 10:1096387-1096409 ATTTGGAGATTGGGCCTCTAAGG 0: 2
1: 34
2: 143
3: 399
4: 703

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062894951 Original CRISPR CCTTCAACACTGAACTTGGG GGG (reversed) Intronic
901435249 1:9243551-9243573 CCTCCAACACTGGCCTTGGTTGG + Intronic
908089531 1:60671409-60671431 CCTTCCCCACTGGAGTTGGGGGG + Intergenic
908416800 1:63921176-63921198 CCGTCAACACAGAACATGGAAGG - Intronic
910662411 1:89688077-89688099 GCTTCAATACTCACCTTGGGAGG - Intronic
915532563 1:156511339-156511361 CTTTCAACATTGAATTTGTGAGG - Intergenic
917304969 1:173615407-173615429 ACTTCAGCACTACACTTGGGGGG - Intronic
918498492 1:185166452-185166474 CATTCAATAATGAACTTCGGTGG - Intronic
918742032 1:188143931-188143953 CCTTCTACAGTGAACTCAGGTGG - Intergenic
920742286 1:208592486-208592508 CCTTCAGCATTGTATTTGGGGGG + Intergenic
922519739 1:226238809-226238831 TCTTCAACACTGATGCTGGGAGG + Intronic
924062427 1:240188834-240188856 CCTTCCACCATGAACTTGTGAGG - Intronic
1062786298 10:268037-268059 CAACCAAAACTGAACTTGGGTGG + Intergenic
1062894951 10:1096343-1096365 CCTTCAACACTGAACTTGGGGGG - Intronic
1063952025 10:11232414-11232436 CCTTCACCCGTGATCTTGGGGGG + Intronic
1070442149 10:76456879-76456901 CCTGCAACACAGAACTTGTTTGG + Intronic
1070484324 10:76914931-76914953 CCATCATCACTGAACTAGGTAGG - Exonic
1070787151 10:79168500-79168522 CCTTCAACACAGAACTGGCCAGG - Intronic
1073357836 10:102870985-102871007 CCGTCATCCCAGAACTTGGGAGG + Intronic
1073527004 10:104192832-104192854 CCTTCCCCACTGAGCTAGGGTGG + Intronic
1077723013 11:4646288-4646310 CCTTCCACACTGAACCTAAGTGG + Intronic
1079257662 11:18846555-18846577 CATCCATCACTGAACTTGGATGG + Intergenic
1080272201 11:30462378-30462400 ACTTATACACTCAACTTGGGCGG + Intronic
1084439559 11:69164799-69164821 CTTTCAACACTAAAATGGGGAGG + Intergenic
1087040166 11:93791406-93791428 CCTTAAAAACTGAACATGGCGGG + Intronic
1088163655 11:106905523-106905545 CCTTCAACACATAACTTTTGGGG + Intronic
1088439856 11:109858038-109858060 CCTTCAACACAGTTCTTAGGAGG + Intergenic
1088925916 11:114302741-114302763 ATTTCAACACAGAAATTGGGAGG - Intronic
1090484299 11:127098821-127098843 CCCTCACCTCTGAACTTGGAGGG - Intergenic
1091109719 11:132954577-132954599 CGTTAAACATTGAACTTGAGGGG + Intronic
1096466572 12:51850005-51850027 CCTTAAGCACTGCCCTTGGGTGG - Intergenic
1096893360 12:54794664-54794686 CATTCAACAATGAATTTTGGGGG - Intergenic
1097180147 12:57167130-57167152 CCTGCAACCCAGCACTTGGGTGG + Intronic
1097440266 12:59599268-59599290 CCTTCAACACTGAATCTGGCAGG + Intronic
1097786825 12:63769633-63769655 CATTCCACATTGAACTTGTGAGG - Intergenic
1100325228 12:93533911-93533933 CCTTCTACACTGAACTAATGAGG - Intergenic
1100363942 12:93902153-93902175 CCATCAACATTGTCCTTGGGAGG + Intergenic
1102233768 12:111281431-111281453 CCATCAACACCGACCCTGGGGGG - Intronic
1104294462 12:127499473-127499495 CCTTCAACACACAAATTTGGGGG - Intergenic
1104522383 12:129487568-129487590 CTTTCAACACTGACTTTGGAGGG - Intronic
1104994299 12:132644518-132644540 CAGTCAACACTGATCTGGGGAGG + Intronic
1105530511 13:21214938-21214960 ACTTCAACAGTGAATTTGGGGGG - Intergenic
1112967752 13:105218801-105218823 ACTTCAAATATGAACTTGGGGGG + Intergenic
1114232884 14:20800075-20800097 CTGTCAACACTTAACCTGGGAGG - Intergenic
1116856703 14:49958987-49959009 CCTTCAATTCTGACCTTGAGTGG + Intergenic
1120082416 14:80230504-80230526 CTTTCCCCACTGAACTTAGGAGG + Intronic
1120847514 14:89139207-89139229 TCTTGAACACAGAAGTTGGGGGG + Intronic
1121778811 14:96608580-96608602 GATTCAACACTGAATTTTGGTGG + Intergenic
1122072974 14:99216714-99216736 CCATAAACACAGAGCTTGGGAGG + Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1125467307 15:39966530-39966552 GCTTCAAAACTGAATTTTGGGGG + Intronic
1128417941 15:67464202-67464224 CCTTGAACATTGAACTGAGGAGG + Intronic
1129726926 15:77906154-77906176 CCCACAACACTGAACTGGGCAGG + Intergenic
1130274923 15:82471410-82471432 CCCACAACACTGAACTGGGCAGG + Intergenic
1130467270 15:84198779-84198801 CCCACAACACTGAACTGGGTAGG + Intergenic
1130496992 15:84474757-84474779 CCCACAACACTGAACTGGGTAGG - Intergenic
1130589567 15:85203377-85203399 CCCACAACACTGAACTGGGCAGG + Intergenic
1132267033 15:100483315-100483337 CCTTAAACAGTGAATTAGGGAGG - Intronic
1133442316 16:5831163-5831185 CCTCCAACACTGGAATTGGTGGG - Intergenic
1134850685 16:17476277-17476299 CCTTCAACACTGCTATTGGCCGG - Intergenic
1135139447 16:19909005-19909027 CCTCCAACACAGATCTTGAGAGG - Intergenic
1135940220 16:26815865-26815887 CCTTCACAACTTACCTTGGGTGG + Intergenic
1139444997 16:66992181-66992203 GCTTCTCCACTGGACTTGGGAGG - Intronic
1140219657 16:73034372-73034394 CCTACAACTCTCATCTTGGGGGG + Intronic
1142258227 16:89026086-89026108 CTTTCAACACTGCCCTTGGTGGG - Intergenic
1144669541 17:17125224-17125246 GCCTCAACACTGACCCTGGGGGG - Intronic
1146152445 17:30486432-30486454 GCTTGAACATTGAACCTGGGAGG + Intronic
1147459502 17:40559270-40559292 CCCTCAAGACTGAGCTTGGTTGG + Intronic
1149558226 17:57589459-57589481 CCTGCAACCCTAAACTTGGAAGG - Intronic
1153673027 18:7430433-7430455 CCTCAAACACTGAGCTGGGGAGG + Intergenic
1156112378 18:33744133-33744155 CTTTCAGCACTTAACTTGGGAGG - Exonic
1156758661 18:40559660-40559682 TTTTCAACACTGTACTTGGCAGG + Intergenic
1162682722 19:12358814-12358836 CATTCAACCCTCAACTTGTGGGG - Intronic
1166872203 19:45877512-45877534 CATTCAACAGTAAAGTTGGGGGG - Intergenic
1167757225 19:51420462-51420484 ACTTCAACACAGAAATTTGGTGG + Intergenic
932544539 2:72694144-72694166 CCTTCAAGAATGAACTGGTGGGG + Intronic
932864578 2:75328083-75328105 CCTTCATCAGAGAACTTGTGAGG - Intergenic
933619986 2:84527711-84527733 CCTTCAGCTCTGAACTTGCTAGG + Intronic
934087183 2:88519649-88519671 CCTTGAACACTCCATTTGGGAGG + Intergenic
941714072 2:168745588-168745610 CCTTCAACCCTAAAATTGGAAGG + Intronic
943466950 2:188239932-188239954 CCTTGAACCTTGAACCTGGGAGG + Intergenic
943690298 2:190862617-190862639 CCTTGAGCTCTGAACCTGGGAGG + Intergenic
947029131 2:225772897-225772919 GCTTGAACTCTGAACCTGGGAGG - Intergenic
948318173 2:237046143-237046165 CCTGCAAGACTGAACTCGAGGGG + Intergenic
948451903 2:238080826-238080848 CTGTCCACCCTGAACTTGGGTGG + Intronic
1175051133 20:56156595-56156617 CCTACTCCACTGATCTTGGGGGG - Intergenic
1175794502 20:61763259-61763281 TCTTCCTCACTGAACTTGGCAGG + Intronic
1181710904 22:24687717-24687739 CCTTCAACACTGATCAAGTGAGG - Intergenic
1184181953 22:42834894-42834916 CCTTCAGTACTGCACTTGAGAGG - Intronic
1184326495 22:43791494-43791516 CCTTCAACGGTGAACGTTGGAGG - Intronic
950381162 3:12616601-12616623 TATTCAACACTACACTTGGGAGG + Intronic
950792962 3:15487953-15487975 CCTACAATACTGAATTTTGGGGG - Intronic
950940876 3:16890070-16890092 CTTTCAACAGTTAACTTGTGTGG - Intronic
951333089 3:21388802-21388824 CCTTCATCAATGATCTTGGATGG - Intergenic
952893714 3:38062360-38062382 CCTTCCAAACTGACCTTGAGAGG - Exonic
955034257 3:55250897-55250919 CCTTCCACACTGAAATTATGAGG - Intergenic
961113329 3:124304805-124304827 CCTTCAACTGGGAACTAGGGTGG - Intronic
962144813 3:132829673-132829695 GCTTCAACACAGGACTTTGGTGG + Intergenic
963323361 3:143834276-143834298 CATTCAACACTGAGCATGGAAGG - Intronic
966516134 3:180822664-180822686 CCATCAACAGTGAACTGGTGAGG + Intronic
969644229 4:8417255-8417277 CCTTAAACAGTGAAGGTGGGCGG - Intronic
971512871 4:27448546-27448568 CCCTCAACACTAAAGTTGAGGGG - Intergenic
978444796 4:108770164-108770186 ACTTCAACACAGAATTTTGGGGG - Intergenic
979824453 4:125216121-125216143 CCATCAGCTCTGAACTTTGGAGG - Intergenic
980688490 4:136260869-136260891 TCTGCAACACTGAACTTGAAAGG + Intergenic
980729030 4:136803725-136803747 CCTTCCATACTGACTTTGGGGGG - Intergenic
981405145 4:144359237-144359259 ACTTGAACCCTGAACCTGGGAGG - Intergenic
983611113 4:169646369-169646391 ACTTCAACACTCCACCTGGGAGG - Intronic
983956805 4:173707532-173707554 CCTTCACCACTGAACTGGCGAGG + Intergenic
986431159 5:7682568-7682590 TCTTCAAGACTGAATCTGGGAGG + Intronic
987070313 5:14330715-14330737 CCTTAAACATTGAACATGGCAGG + Intronic
989706613 5:44340215-44340237 GCATCAACACAGAATTTGGGAGG + Intronic
990551473 5:56884267-56884289 CTTTCAACAGTGTACTTGTGCGG + Intronic
990863776 5:60357849-60357871 CCTCAAATACTGAACTTAGGTGG + Intronic
993317348 5:86427782-86427804 CATTCAGCTCTGAACTCGGGAGG + Intergenic
995837939 5:116416668-116416690 CCTTCAACTCTGAAATCGAGAGG - Intergenic
995954954 5:117766531-117766553 CCTTCAGCCCTGACCTTGGCTGG + Intergenic
998209637 5:140184850-140184872 CCTCCAATACTAAACTTGGTAGG - Intronic
998720295 5:144938632-144938654 CCTTCAACACTTAGCTTGAAAGG - Intergenic
1003235287 6:4289761-4289783 GCTTCAACACAGAAATTTGGGGG + Intergenic
1003311270 6:4971817-4971839 ACTTCAACAGTGAATTTTGGGGG + Intergenic
1003400935 6:5790309-5790331 ACTTCAACAGTGAATTTGGGGGG + Intergenic
1005736519 6:28752906-28752928 CCTTCAACCTTGTTCTTGGGTGG + Intergenic
1007303169 6:40883983-40884005 ACTTCAACACAGAACTTCTGAGG + Intergenic
1013180383 6:107712394-107712416 CCTTCAACACTGTAGTTGAAGGG - Intronic
1015231064 6:130915335-130915357 CCTTCAAACATGAAATTGGGAGG + Intronic
1020427604 7:8086665-8086687 TCTTAAACACTGATCTTGGCAGG + Exonic
1021698084 7:23293006-23293028 CCTTTCACAATGGACTTGGGGGG - Intergenic
1024777820 7:52808343-52808365 CCTCCAACATGGAACTCGGGAGG - Intergenic
1026823266 7:73564230-73564252 CCTTCAACCCAGAACCCGGGAGG - Intergenic
1027401591 7:77814489-77814511 ACTTCAGCACTACACTTGGGGGG + Intronic
1030017003 7:105232928-105232950 ACTTGATCACTGAACTTGGGAGG + Intronic
1031396126 7:121276649-121276671 CCTTCAACAATTAACTTGGATGG - Intronic
1033044691 7:137951208-137951230 ACTTCAGCACTGTGCTTGGGAGG - Intronic
1043533798 8:81177736-81177758 CCTCCAACACTGGGTTTGGGCGG + Intergenic
1043746997 8:83886912-83886934 CCTTCAACATTGAACTCATGAGG + Intergenic
1052374283 9:27700419-27700441 CCTTCAAGATTGCACCTGGGAGG + Intergenic
1052804759 9:33002875-33002897 CCTTCAAGACAGAAGGTGGGAGG + Intronic
1055435587 9:76288904-76288926 CCTTCACCATTGAATTTGGATGG - Intronic
1056095572 9:83250215-83250237 CACTCAACACTGCACTTGGCTGG - Intronic
1057085042 9:92202288-92202310 CCTTCAATACAGAATATGGGAGG + Intergenic
1057135092 9:92681856-92681878 GCTTCAACATTGAATTTTGGGGG + Intergenic
1059051159 9:110926904-110926926 CCTTCAACAATGACCGTGTGAGG - Intronic
1061958006 9:133973646-133973668 CCTTGATCACTGGAATTGGGAGG - Intronic
1186073427 X:5849184-5849206 CCTTCAAGACAGAACATGAGTGG - Intronic
1193317659 X:80082522-80082544 AGTTTAACCCTGAACTTGGGAGG + Intergenic
1197371282 X:125628634-125628656 CCTTCAAGCCTGAACTTAGAGGG - Intergenic
1201025521 Y:9700692-9700714 ACTTCAACACTGCACCTTGGTGG - Intergenic
1202368864 Y:24184239-24184261 CCCACAACACTGAACTGGGCTGG - Intergenic
1202501921 Y:25485878-25485900 CCCACAACACTGAACTGGGCTGG + Intergenic