ID: 1062895093

View in Genome Browser
Species Human (GRCh38)
Location 10:1097311-1097333
Sequence ACCGCAGCAGGATCCAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062895088_1062895093 -5 Left 1062895088 10:1097293-1097315 CCACAGCTTTAAGCACCCACCGC 0: 1
1: 0
2: 0
3: 26
4: 290
Right 1062895093 10:1097311-1097333 ACCGCAGCAGGATCCAGGACTGG No data
1062895083_1062895093 27 Left 1062895083 10:1097261-1097283 CCAGTTGACAGGGAGGCGAGTGT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1062895093 10:1097311-1097333 ACCGCAGCAGGATCCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062895093 Original CRISPR ACCGCAGCAGGATCCAGGAC TGG Intronic
No off target data available for this crispr