ID: 1062895582

View in Genome Browser
Species Human (GRCh38)
Location 10:1100909-1100931
Sequence CGTGCAGCTCAGTCGGGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062895582_1062895588 3 Left 1062895582 10:1100909-1100931 CCCCGTCCCGACTGAGCTGCACG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1062895588 10:1100935-1100957 CACCCTGAACTTGCTGTCTCTGG No data
1062895582_1062895589 4 Left 1062895582 10:1100909-1100931 CCCCGTCCCGACTGAGCTGCACG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1062895589 10:1100936-1100958 ACCCTGAACTTGCTGTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062895582 Original CRISPR CGTGCAGCTCAGTCGGGACG GGG (reversed) Intronic
914463086 1:147902721-147902743 CGTGCAGCACAGTAGGGGCGGGG + Intergenic
919726328 1:200887223-200887245 GGTGCAGCCCAGCTGGGACGTGG + Intergenic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
922790654 1:228309133-228309155 CGTGCAGCTCAGTGAGGGCCAGG + Exonic
1062895582 10:1100909-1100931 CGTGCAGCTCAGTCGGGACGGGG - Intronic
1069877567 10:71572462-71572484 CGTGCAGTTCAGCAGGGACAGGG + Intronic
1077227083 11:1443157-1443179 CGTGCAGCTCTGTGGGGCCCAGG + Intronic
1083809644 11:65096421-65096443 CGTTCAGATCAGTCGGGTCCAGG - Exonic
1094480233 12:30875688-30875710 AGTGCAGCTCAGTAGGGAGGGGG - Intergenic
1103800223 12:123533248-123533270 CGTCCAGCTCGGGCGCGACGTGG + Exonic
1103899573 12:124296263-124296285 CGTGGAGCTTAGGCGGGAGGGGG + Intronic
1109382969 13:61589072-61589094 CCTGCAGCTGAGTTGGGAAGTGG - Intergenic
1116467783 14:45253464-45253486 CGTGAAGCTCTGCCGGGACAAGG + Intronic
1119621636 14:76136096-76136118 TGTGCAGCTCAGTCAGGCTGGGG - Intergenic
1121324019 14:93009407-93009429 TGTGCAGCCCAGTTGGGACAGGG - Intronic
1122071977 14:99210833-99210855 AGTGCAGCTAAGTCAGGAGGAGG - Intronic
1122136482 14:99635727-99635749 CCTGCAGCTCAGGAGGGACATGG + Intergenic
1125721385 15:41846769-41846791 CCTGCAGCCCACTCGGGACGTGG + Exonic
1129539787 15:76340340-76340362 CGTTCAGCACAGTCCGCACGCGG - Exonic
1134084565 16:11347447-11347469 CAGGCAGCTCAGTTGGGAAGGGG - Intronic
1134790034 16:16981516-16981538 CGTGAAGCTCAGTTGTGACAAGG + Intergenic
1148075374 17:44932620-44932642 CCTGCAGCTCAGCCAGGATGGGG - Intronic
1148334465 17:46832280-46832302 CGGGCAGCTCAGCCGGCCCGGGG - Intronic
1151216308 17:72579063-72579085 CGTGCAGCTCAGATGGGGCAAGG + Intergenic
1153775818 18:8452550-8452572 AGAGCAGCTCAGAAGGGACGGGG - Intergenic
1153950485 18:10054092-10054114 ATTGCAGCTGAGTCGGGACAGGG + Intergenic
1154214488 18:12406255-12406277 AGTGCAGCACAGTGGGGAGGGGG + Intergenic
1160037792 18:75317518-75317540 CGTGCATTTCACTCGGGGCGTGG + Intergenic
1163290763 19:16377677-16377699 CGGCCAGCTCAGTGGGGAGGCGG - Intronic
947588387 2:231370778-231370800 GGTTCAGCTCAGTTGGGGCGTGG - Intronic
948950037 2:241243518-241243540 CCTGCAGCTCAGTCGGGGCCTGG + Intronic
948950046 2:241243576-241243598 CCTGCAGCTCAGTCGGGGCCTGG + Intronic
948950053 2:241243634-241243656 CCTGCAGCTCAGTCGGAGCCTGG + Intronic
1171041472 20:21767820-21767842 AGCGCAGCTCCGGCGGGACGAGG - Intergenic
1171090682 20:22283422-22283444 CGTGGAGCTGGGTGGGGACGTGG + Intergenic
1175337471 20:58205747-58205769 GGTGCGGCGCAGACGGGACGTGG - Intergenic
1179022992 21:37656663-37656685 CGTCCAGCTCAGGCAGGCCGGGG - Intronic
1182160194 22:28113921-28113943 CTTGCAGCTAAGTCCTGACGTGG + Intronic
1184093444 22:42304222-42304244 CGGGCAGCTAAGGCGGGGCGGGG - Intronic
1184829070 22:46972445-46972467 GGTGCGGCTCAGTCGTGAAGAGG + Intronic
950012200 3:9731702-9731724 AGTGCAGCTCAGTAGCGCCGCGG + Intergenic
954316090 3:49802749-49802771 CGTCTAGCTCGGTTGGGACGCGG + Intergenic
968712037 4:2126447-2126469 TGTGGAGCACAGTAGGGACGAGG + Intronic
975656413 4:76645447-76645469 CGTGCTGCCCAGGTGGGACGTGG - Intronic
990042344 5:51389713-51389735 CGTTCAGCACAGTCCGCACGCGG - Exonic
997698571 5:135880482-135880504 TGTGCAGTTCAGTAGGGAGGTGG - Intronic
1019956517 7:4419008-4419030 AGTGCAGCTCAGTTGGCATGGGG - Intergenic
1035031478 7:155863800-155863822 GGTGCAGGTCAGGCCGGACGGGG - Intergenic
1036992715 8:13616946-13616968 CCTGCAGCTTAGTCTGGAAGGGG - Intergenic
1047688226 8:127322999-127323021 TGTGCAGGTCAGTGGGGACCTGG - Intergenic
1048555457 8:135471493-135471515 TGTTCAGCTCAGTGGGGAAGTGG + Intronic
1052300396 9:26947007-26947029 CGAGCAGCTCAGCCGGTACCTGG + Exonic
1059669239 9:116477454-116477476 CTCGGAGCTCAGTAGGGACGGGG - Intronic
1059816966 9:117927527-117927549 GGTGCACCTGAGTCGGGAAGTGG + Intergenic
1059938186 9:119332727-119332749 CCTGCAGTTCAGTGGGGAAGGGG - Intronic
1060473773 9:123970315-123970337 CGTGCAGCCCATTCGGGGCTGGG + Intergenic
1062554495 9:137107833-137107855 CATGAAGCTCAGTGGGGATGGGG - Intronic