ID: 1062895700

View in Genome Browser
Species Human (GRCh38)
Location 10:1101582-1101604
Sequence CTGTGTGAACAAACTGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062895700_1062895706 15 Left 1062895700 10:1101582-1101604 CCCTCCGCAGTTTGTTCACACAG 0: 1
1: 0
2: 1
3: 5
4: 98
Right 1062895706 10:1101620-1101642 ACATCCTGCCGACAGCCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062895700 Original CRISPR CTGTGTGAACAAACTGCGGA GGG (reversed) Intronic
906323225 1:44829279-44829301 CTGTGTGACCATGCTGCGGTGGG - Exonic
907215588 1:52860810-52860832 CTCTGTGAACAGCCTGTGGAGGG - Exonic
908088775 1:60664575-60664597 CTGTGTAAACAAACAGGGGTAGG + Intergenic
910048511 1:82947527-82947549 CTGTGGCAACAAACTGTGTAAGG - Intergenic
912348190 1:108985450-108985472 CTGTGAGAATAAAATGGGGATGG - Intronic
912364076 1:109118597-109118619 CTGTGTGAAAAACATGCTGACGG + Intronic
914755430 1:150559331-150559353 CTGTGTATCCAAACTGGGGACGG + Exonic
1062895700 10:1101582-1101604 CTGTGTGAACAAACTGCGGAGGG - Intronic
1066930945 10:41757789-41757811 CTGTGTTTCCAAACTGCTGAAGG - Intergenic
1067656353 10:48194838-48194860 CTGGGTGGACAAACAGTGGAGGG + Intronic
1070149867 10:73799107-73799129 CTGTATGAGCAAACTGCAGGTGG + Exonic
1073945696 10:108747379-108747401 CTGTAGGGACAAACTGCAGAGGG + Intergenic
1076151185 10:128163169-128163191 CTGTGGGAATAAAAGGCGGACGG - Intergenic
1077030351 11:462722-462744 CTGTGTGGACACCCTGCGTAGGG - Intronic
1077400441 11:2353505-2353527 CTGTGTCACCACACTGTGGATGG + Intergenic
1080794682 11:35552539-35552561 CTGTGTGACCAAATTTTGGAGGG - Intergenic
1082232296 11:49782214-49782236 CTCCGTGAACAAACTGCAAAGGG - Intergenic
1082596757 11:55091189-55091211 GTGTGTGAAAAATCTGCGAAGGG - Intergenic
1084900495 11:72306560-72306582 GAGTGTGAACAAACAGGGGATGG + Intronic
1085528280 11:77176543-77176565 CTGTGTGGGCAAAGTGGGGAAGG + Intronic
1088176837 11:107062563-107062585 CTGTGAGAATAAACTCCAGAAGG - Intergenic
1089485262 11:118840780-118840802 CTGTGTCAACAAAATGATGATGG - Intergenic
1092696498 12:11177453-11177475 CTGTGTGACCAAACTGGGTTGGG + Intergenic
1092963559 12:13619504-13619526 CTGCGTGAACAAACTACTGTTGG - Intronic
1093010406 12:14101338-14101360 CTGAGTGCCCAAACTGTGGAAGG + Intergenic
1094688066 12:32739942-32739964 CTGTCTGAATAAACTTCAGATGG + Intronic
1101320517 12:103669300-103669322 CTGTGCGAACAGACAGAGGAAGG - Intronic
1102960256 12:117088130-117088152 CTGTATGCCCAAACTGAGGAGGG + Intronic
1113402172 13:110004349-110004371 GTGGGTGAACAAAATGCTGAAGG + Intergenic
1116100416 14:40426667-40426689 CCATGTGAACAAACTGCAGTGGG + Intergenic
1117051804 14:51867689-51867711 CTGTGGGGACAAAGTGTGGAAGG - Intronic
1118989027 14:70781353-70781375 GTGTGTGAACAACCTTCAGATGG + Intronic
1121087620 14:91158367-91158389 CTGTGGGAACAAAGTGCTGTGGG - Intronic
1122093589 14:99355266-99355288 CTGGGTGAAGTAACTGCTGAAGG - Intergenic
1123002854 14:105305600-105305622 CAGTGTGAACCAACTGAGGCAGG + Exonic
1128109950 15:65069969-65069991 CTGGGTGAGGAAACTGGGGATGG - Intronic
1128639514 15:69325805-69325827 CTGTGCGTAGAAACTGCGGTGGG - Intronic
1129649772 15:77476038-77476060 CTGTGTGAACCACCTGCCAATGG - Intronic
1129862732 15:78875225-78875247 CTGTGGGAACAACCTAAGGATGG + Intronic
1133568714 16:7020680-7020702 CTGTGTCATCACACTGCAGAGGG + Intronic
1134031789 16:10998060-10998082 CTGTGTGCAGAAACTGCAAAGGG - Intronic
1136738268 16:32484423-32484445 CAGTGTTTACAAACTGCTGAAGG - Intergenic
1136765521 16:32773472-32773494 CTGTTTGGAGAAGCTGCGGAAGG - Intergenic
1136802578 16:33096907-33096929 CTGTTTGGAGAAGCTGCGGAAGG + Intergenic
1142084876 16:88172241-88172263 GCGTGTGAAGAAACTGCTGAAGG + Intergenic
1203011676 16_KI270728v1_random:297338-297360 CTGTGTTACCAAACTGCTGAAGG - Intergenic
1203030011 16_KI270728v1_random:570497-570519 CTGTGTTACCAAACTGCTGAAGG - Intergenic
1203041710 16_KI270728v1_random:763934-763956 CTGTGTTACCAAACTGCTGAAGG + Intergenic
1143933753 17:10460322-10460344 CTGTGTGAACAAGGTGAGAATGG + Intronic
1148451918 17:47784147-47784169 TTGTGTGTACAAGCTGGGGAAGG - Intergenic
1150187196 17:63195702-63195724 CTGTGTGAACAGACTACAGGGGG - Intronic
1157390086 18:47294451-47294473 ATGTGTGATCAAGCTGGGGAAGG + Intergenic
1157501780 18:48195745-48195767 GTGGGTGAAACAACTGCGGAAGG - Intronic
1159957172 18:74527033-74527055 CTGTGAGATAAAACTGAGGAAGG - Intergenic
1162523398 19:11194660-11194682 CTGGGTGAACCAGCTGTGGAGGG - Intronic
926653095 2:15367949-15367971 CTGTGTGAATATACAGAGGAAGG - Intronic
933774135 2:85761644-85761666 CTGTGTGAAAACAGTGCTGAGGG + Intronic
936465953 2:112750280-112750302 CTGTGTGCACAAGATGCTGAAGG - Intronic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
943369993 2:187003670-187003692 CTGTGTGTAAAGACTGTGGAAGG - Intergenic
1172112099 20:32553061-32553083 CTGTGTGAGGAATCTGAGGACGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174172205 20:48624640-48624662 CTGGGGGGACAAACTGCCGAGGG + Exonic
1177160654 21:17544585-17544607 CTGTGTGAACAAACCACAGAGGG - Intronic
1183452174 22:37902722-37902744 ATGTGTGAACAAGGTGTGGAAGG + Intergenic
957154535 3:76530713-76530735 ATGTGTGCACAAACTTTGGAAGG + Intronic
961945694 3:130684890-130684912 TTGTGTGAATAAACTGCACAGGG - Intronic
962321863 3:134397002-134397024 CTGTGTGTGAAAACTGTGGATGG - Intergenic
965153654 3:165015987-165016009 TTTTGTCAACAAACTGAGGAAGG + Exonic
966595557 3:181722244-181722266 CTGTTTGAACAATCTGCGATGGG + Intergenic
967902132 3:194465413-194465435 GTGTGTGAAGAAACTACCGAAGG + Intronic
968222967 3:196952085-196952107 CTGTCTGAACAAACTGAAAATGG + Intronic
969223171 4:5774585-5774607 CTGTGTGAGAAACCTGGGGAGGG + Intronic
969454293 4:7292286-7292308 CTTGGTGAACAGACTGCGAATGG - Intronic
969454300 4:7292320-7292342 CTTGGTGAACAGACTGCGAATGG - Intronic
972336633 4:38112829-38112851 CTGTGTGACCTGACTGTGGATGG + Intronic
974159993 4:58126101-58126123 CTCTGTGAACAAAGTACTGATGG + Intergenic
975384427 4:73739202-73739224 CACTGTGAACACACTGTGGAGGG - Intergenic
975542711 4:75531339-75531361 CTGTGTGATTACACTGAGGAAGG + Intronic
981148724 4:141356241-141356263 CTGTGTGAACAAGTTTGGGAGGG + Intergenic
981954835 4:150457784-150457806 CTGGGTGTACAAACTGAGGTAGG - Intronic
985493040 5:190225-190247 CTCAGGGAACAAACTGGGGAGGG + Intergenic
986350932 5:6878714-6878736 CTCTGTGAACTAACTGAGAAAGG - Intergenic
989238626 5:39178300-39178322 ATGTGTGAACATCCTGCAGAAGG + Intronic
989830414 5:45910506-45910528 CAGTGTTTACAAACTGCTGAAGG - Intergenic
1007451450 6:41942597-41942619 CTGTTTGGAGAAACTGTGGACGG + Intronic
1008292615 6:49736342-49736364 GGGTGTGAACAAGCTGTGGAAGG - Intronic
1011855401 6:91683469-91683491 CTGTGTGAACAAACCCCGGAGGG - Intergenic
1013407202 6:109853772-109853794 CAGTGTGGACAACCTGCAGAAGG + Intergenic
1025526516 7:61819572-61819594 CAGTGTTTACAAACTGCTGAAGG - Intergenic
1025549892 7:62232128-62232150 CAGTGTTTACAAACTGCTGAAGG - Intergenic
1026439227 7:70429066-70429088 ATGTGTGAACATACTGAGGGAGG - Intronic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1034140676 7:148812661-148812683 CTTTCTGAACAAAGTGAGGAAGG + Intronic
1034871647 7:154690528-154690550 CTGTGTGGAGAAACAGCTGAAGG - Intronic
1036619087 8:10411286-10411308 CGGTGTGAACACACAGAGGACGG - Intronic
1037169782 8:15877405-15877427 ATGTGTGCTCAAACTGCTGATGG - Intergenic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1044618391 8:94165467-94165489 CCGTGAGAAAAAATTGCGGAAGG - Intronic
1049364217 8:142228927-142228949 ATGTGTGAACAGATTGTGGATGG + Intronic
1061567657 9:131454241-131454263 CTGTGTGAACACAGTGTGGTAGG - Intronic
1189128080 X:38469082-38469104 CTGTTTGAAAAAGATGCGGAAGG - Intronic
1190086491 X:47399611-47399633 CTGTGAGCACAAACTTGGGAAGG + Intronic
1197219041 X:123894108-123894130 CTCTGTGAAGAAGCTGGGGAAGG - Intronic
1198196291 X:134366020-134366042 CTGTGTGAACATACTGCTGCAGG + Intergenic