ID: 1062901746

View in Genome Browser
Species Human (GRCh38)
Location 10:1151876-1151898
Sequence CAGATGAGACCCAAATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062901746_1062901748 -5 Left 1062901746 10:1151876-1151898 CCTGGCTATTTGGGTCTCATCTG No data
Right 1062901748 10:1151894-1151916 ATCTGTCTCCAAGATTTGATGGG No data
1062901746_1062901747 -6 Left 1062901746 10:1151876-1151898 CCTGGCTATTTGGGTCTCATCTG No data
Right 1062901747 10:1151893-1151915 CATCTGTCTCCAAGATTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062901746 Original CRISPR CAGATGAGACCCAAATAGCC AGG (reversed) Intergenic
No off target data available for this crispr