ID: 1062902031

View in Genome Browser
Species Human (GRCh38)
Location 10:1153858-1153880
Sequence GACATCGTAGGGGCCTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062902023_1062902031 -3 Left 1062902023 10:1153838-1153860 CCACGCAGCCTGTGCAGGGCGAC No data
Right 1062902031 10:1153858-1153880 GACATCGTAGGGGCCTGGGGTGG No data
1062902020_1062902031 30 Left 1062902020 10:1153805-1153827 CCGTGTTGTTTTTCAAGGAAACA No data
Right 1062902031 10:1153858-1153880 GACATCGTAGGGGCCTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062902031 Original CRISPR GACATCGTAGGGGCCTGGGG TGG Intergenic
No off target data available for this crispr