ID: 1062902431

View in Genome Browser
Species Human (GRCh38)
Location 10:1156321-1156343
Sequence GGTCCCGTGTCCCCAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062902420_1062902431 13 Left 1062902420 10:1156285-1156307 CCCAGTGCAGGCTAGGCTCTGTG No data
Right 1062902431 10:1156321-1156343 GGTCCCGTGTCCCCAGGGCTGGG No data
1062902414_1062902431 28 Left 1062902414 10:1156270-1156292 CCTGGGCCCTGTATCCCCAGTGC No data
Right 1062902431 10:1156321-1156343 GGTCCCGTGTCCCCAGGGCTGGG No data
1062902413_1062902431 29 Left 1062902413 10:1156269-1156291 CCCTGGGCCCTGTATCCCCAGTG No data
Right 1062902431 10:1156321-1156343 GGTCCCGTGTCCCCAGGGCTGGG No data
1062902416_1062902431 22 Left 1062902416 10:1156276-1156298 CCCTGTATCCCCAGTGCAGGCTA No data
Right 1062902431 10:1156321-1156343 GGTCCCGTGTCCCCAGGGCTGGG No data
1062902421_1062902431 12 Left 1062902421 10:1156286-1156308 CCAGTGCAGGCTAGGCTCTGTGG No data
Right 1062902431 10:1156321-1156343 GGTCCCGTGTCCCCAGGGCTGGG No data
1062902417_1062902431 21 Left 1062902417 10:1156277-1156299 CCTGTATCCCCAGTGCAGGCTAG No data
Right 1062902431 10:1156321-1156343 GGTCCCGTGTCCCCAGGGCTGGG No data
1062902419_1062902431 14 Left 1062902419 10:1156284-1156306 CCCCAGTGCAGGCTAGGCTCTGT No data
Right 1062902431 10:1156321-1156343 GGTCCCGTGTCCCCAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062902431 Original CRISPR GGTCCCGTGTCCCCAGGGCT GGG Intergenic