ID: 1062902450

View in Genome Browser
Species Human (GRCh38)
Location 10:1156369-1156391
Sequence GGTCCCGTGTCCCCAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062902436_1062902450 14 Left 1062902436 10:1156332-1156354 CCCAGGGCTGGGCTCTGTGGCTC No data
Right 1062902450 10:1156369-1156391 GGTCCCGTGTCCCCAGGGCTGGG No data
1062902432_1062902450 22 Left 1062902432 10:1156324-1156346 CCCGTGTCCCCAGGGCTGGGCTC No data
Right 1062902450 10:1156369-1156391 GGTCCCGTGTCCCCAGGGCTGGG No data
1062902433_1062902450 21 Left 1062902433 10:1156325-1156347 CCGTGTCCCCAGGGCTGGGCTCT No data
Right 1062902450 10:1156369-1156391 GGTCCCGTGTCCCCAGGGCTGGG No data
1062902435_1062902450 15 Left 1062902435 10:1156331-1156353 CCCCAGGGCTGGGCTCTGTGGCT No data
Right 1062902450 10:1156369-1156391 GGTCCCGTGTCCCCAGGGCTGGG No data
1062902429_1062902450 29 Left 1062902429 10:1156317-1156339 CCTCGGTCCCGTGTCCCCAGGGC No data
Right 1062902450 10:1156369-1156391 GGTCCCGTGTCCCCAGGGCTGGG No data
1062902437_1062902450 13 Left 1062902437 10:1156333-1156355 CCAGGGCTGGGCTCTGTGGCTCT No data
Right 1062902450 10:1156369-1156391 GGTCCCGTGTCCCCAGGGCTGGG No data
1062902427_1062902450 30 Left 1062902427 10:1156316-1156338 CCCTCGGTCCCGTGTCCCCAGGG No data
Right 1062902450 10:1156369-1156391 GGTCCCGTGTCCCCAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062902450 Original CRISPR GGTCCCGTGTCCCCAGGGCT GGG Intergenic