ID: 1062903540

View in Genome Browser
Species Human (GRCh38)
Location 10:1163722-1163744
Sequence GTCCCACTTGTGGCCCCAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062903535_1062903540 19 Left 1062903535 10:1163680-1163702 CCACACACAGGACCAAAGTTGAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1062903540 10:1163722-1163744 GTCCCACTTGTGGCCCCAGTCGG 0: 1
1: 0
2: 2
3: 16
4: 184
1062903537_1062903540 7 Left 1062903537 10:1163692-1163714 CCAAAGTTGAGATAGGCGCACAT 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1062903540 10:1163722-1163744 GTCCCACTTGTGGCCCCAGTCGG 0: 1
1: 0
2: 2
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062903540 Original CRISPR GTCCCACTTGTGGCCCCAGT CGG Intergenic