ID: 1062903540

View in Genome Browser
Species Human (GRCh38)
Location 10:1163722-1163744
Sequence GTCCCACTTGTGGCCCCAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062903535_1062903540 19 Left 1062903535 10:1163680-1163702 CCACACACAGGACCAAAGTTGAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1062903540 10:1163722-1163744 GTCCCACTTGTGGCCCCAGTCGG 0: 1
1: 0
2: 2
3: 16
4: 184
1062903537_1062903540 7 Left 1062903537 10:1163692-1163714 CCAAAGTTGAGATAGGCGCACAT 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1062903540 10:1163722-1163744 GTCCCACTTGTGGCCCCAGTCGG 0: 1
1: 0
2: 2
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062903540 Original CRISPR GTCCCACTTGTGGCCCCAGT CGG Intergenic
900999967 1:6144017-6144039 GACCCACCTGTGGCCCCAGTAGG + Exonic
901123076 1:6910769-6910791 TTCCCACATATAGCCCCAGTAGG - Intronic
902067611 1:13700657-13700679 GCCCCACGTGGGGCCCCAGGTGG - Intronic
903933996 1:26882185-26882207 GTCAATCTTGTTGCCCCAGTTGG - Intronic
905103489 1:35546157-35546179 GTCCCACTTGTGGTCTCCCTGGG - Intronic
905105067 1:35559088-35559110 GTCCCTCTTGTGTTCACAGTTGG + Exonic
906034482 1:42741775-42741797 GTGCCCATTGCGGCCCCAGTAGG - Intergenic
906868185 1:49446566-49446588 GCCCCAGTTGTGGCATCAGTTGG + Intronic
906907735 1:49913821-49913843 GTCCTAGTTGTGGCTCAAGTAGG - Intronic
907546472 1:55264031-55264053 GTCTCACTTGTTGCCCAAGCTGG + Intergenic
908266223 1:62381916-62381938 CCCCCACTTGTTGCCCCAGTTGG + Intergenic
912019443 1:105088286-105088308 TTCCCTCTTGTTGCCCTAGTTGG - Intergenic
914850701 1:151311834-151311856 GTCACACTGGAAGCCCCAGTAGG - Intronic
914938550 1:152001900-152001922 GACCCTCTGGTGGCCACAGTGGG + Intergenic
917438383 1:175044136-175044158 GTCACTCCTGTGGCCCCAGAGGG - Intergenic
918006194 1:180544073-180544095 ATCCCTCTTCTGGCTCCAGTGGG + Intergenic
920150303 1:203900649-203900671 GCTCCACCTGTGGCCCCAGTGGG + Intergenic
921046201 1:211479518-211479540 CTGCCACTTCTGGCCTCAGTTGG + Intronic
922721615 1:227902836-227902858 GTCCCACTGTGGGCACCAGTGGG + Intergenic
922721617 1:227902838-227902860 GCCCCACTGGTGCCCACAGTGGG - Intergenic
923443313 1:234041972-234041994 GTCCCCCTTATGGCATCAGTGGG + Intronic
923623165 1:235594382-235594404 GCTCCACCTGTGGCCCCAGATGG - Intronic
924343094 1:243053183-243053205 CTCCATCTTGTAGCCCCAGTAGG - Intergenic
1062882684 10:991030-991052 GTCTCACTTGTAGGCCCAGAGGG + Intronic
1062882697 10:991110-991132 GTCTCACTTGTAGGCCCAGAGGG + Intronic
1062903540 10:1163722-1163744 GTCCCACTTGTGGCCCCAGTCGG + Intergenic
1063704027 10:8413321-8413343 GTCTCACTTGTTGCCCAAGCTGG - Intergenic
1065236376 10:23657054-23657076 GGCCCACTTTTGGCTCTAGTGGG - Intergenic
1068774533 10:60855934-60855956 GTCCGACTTGTGGCTTCACTGGG + Intergenic
1070040296 10:72771829-72771851 TCCCCACTACTGGCCCCAGTAGG + Intronic
1070364431 10:75722604-75722626 GTCAGATTTGTGGCTCCAGTTGG - Intronic
1072295820 10:94008768-94008790 GTGCCTCTTGTTGCCCCAGATGG - Intronic
1072313628 10:94181018-94181040 GTCCTACCTGTGCTCCCAGTTGG + Intronic
1072445626 10:95496339-95496361 GCACCAGTTATGGCCCCAGTGGG - Intronic
1076270281 10:129146781-129146803 GTCCCCCTTATGACCCCACTTGG + Intergenic
1076625045 10:131816479-131816501 GTCCCACTTTGGGCCAAAGTGGG + Intergenic
1076813013 10:132898906-132898928 GACCCACTAGAGGCCTCAGTGGG + Intronic
1077415918 11:2424244-2424266 GGCCCACCTGTGACCCCAGGAGG + Intergenic
1077538326 11:3134917-3134939 ATCCCACTTGTGGTCCCACTAGG + Intronic
1078221923 11:9358798-9358820 TTCGCTCTTGTTGCCCCAGTTGG + Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1084208788 11:67611384-67611406 GACCGACTTGGGGCCCCAGGGGG + Exonic
1085050840 11:73379389-73379411 TTTCCACTTGTGACCACAGTTGG + Intronic
1087345145 11:96962493-96962515 GTCCCATTTGTGGGTCCAGTAGG - Intergenic
1089618150 11:119706853-119706875 ATCCCACTTTTGTCCTCAGTGGG + Intronic
1089766554 11:120771760-120771782 GCCCCAGGTGTGGCTCCAGTGGG + Intronic
1094731003 12:33175983-33176005 TTCACACTTGTTGCCCAAGTTGG + Intergenic
1094772999 12:33688027-33688049 CTCACTCTTGTTGCCCCAGTTGG + Intergenic
1096066099 12:48742108-48742130 GTCTCACTTGTTGCCCAGGTTGG + Intergenic
1096125785 12:49118583-49118605 GTCTCACTAGTTGCCCAAGTTGG + Intergenic
1096295934 12:50384086-50384108 GTCTCACTTGTCGCCCAGGTTGG - Intronic
1096361605 12:50992700-50992722 GTCTCACTCGTCGCCCAAGTTGG - Intronic
1102308757 12:111827405-111827427 TTCCCTCTTGTTGCCCCAGCTGG + Intergenic
1104892757 12:132148338-132148360 GTGCCACCTGTGGGCCCCGTGGG + Intronic
1104949526 12:132432955-132432977 GTCCCTCTCGGGGCCCCACTTGG - Intergenic
1108221737 13:48241193-48241215 TTCTCACTTTTTGCCCCAGTAGG + Intronic
1109229946 13:59744436-59744458 GTCCAACTTGTGGCCCAGGATGG + Intronic
1110854125 13:80278603-80278625 GCTCCACCTGCGGCCCCAGTGGG - Intergenic
1113450098 13:110402953-110402975 GCCCCAGCTGTGGCTCCAGTGGG - Intronic
1113659744 13:112097645-112097667 CTCCCTCTTGAGGCCTCAGTGGG - Intergenic
1115373406 14:32645475-32645497 GTCTCACTTGTTGCCCTAGCTGG + Intronic
1117373148 14:55097098-55097120 GGGCCAGTGGTGGCCCCAGTAGG + Intergenic
1118828383 14:69405554-69405576 GTCTCACTTGTTGCCCAGGTTGG - Intronic
1122057986 14:99118039-99118061 CTCCCACTTGTGGCCTCGGAGGG - Intergenic
1122517634 14:102319853-102319875 GTCGCACGTGTGGCCCCGCTGGG + Exonic
1122783701 14:104154419-104154441 GCCCCACCTGTGGCCGCAGGAGG - Intronic
1124354142 15:28982986-28983008 GACACACTTGTGGCCTCCGTAGG - Intronic
1125638051 15:41205907-41205929 GTCTCATTTGTGGCCCAAGCTGG + Intronic
1133286302 16:4692389-4692411 GACCCACTGGTGGCCACAGGAGG + Intergenic
1133381774 16:5336897-5336919 GTAGCTCTTGTGTCCCCAGTGGG - Intergenic
1133921135 16:10154199-10154221 GCCTCACTTGTGGGCCCAGATGG - Intronic
1135683492 16:24478902-24478924 ATCTCACTGGTGGCCACAGTTGG + Intergenic
1135997757 16:27265361-27265383 GTCTCACCTGTTGCCCCAGCTGG + Intronic
1136011906 16:27368887-27368909 GTCCCACTTGTTGCCCAGGCTGG - Intergenic
1138267763 16:55672052-55672074 GTTCCAGGTGTGGCCACAGTCGG - Exonic
1139128293 16:64108825-64108847 GTCCCAGTTGTGGCTCAAGTGGG + Intergenic
1139509189 16:67416582-67416604 GACCCTCTTGGTGCCCCAGTCGG + Intronic
1141698414 16:85631487-85631509 CTCCCCATTGTGGCTCCAGTGGG + Intronic
1142269109 16:89079910-89079932 CTCCCACTGGTGGCACCAGCTGG + Intergenic
1145867542 17:28250571-28250593 GTCCTACCTGGGGCCCCAGGAGG + Intergenic
1146916572 17:36681935-36681957 GACATACTGGTGGCCCCAGTTGG + Intergenic
1148863544 17:50617254-50617276 GTCCTACTCGTGCCACCAGTTGG + Intronic
1152279363 17:79376269-79376291 CTCCCATTTTTGGCCCCACTTGG + Intronic
1152607958 17:81302523-81302545 ATCCAAATTGGGGCCCCAGTGGG + Intergenic
1152782289 17:82231709-82231731 GCCCCACTTGGGGCACCAGTGGG + Intronic
1153643984 18:7178616-7178638 GCTCCACCTGTGGCCCCGGTGGG - Intergenic
1156046311 18:32881368-32881390 CCACCACTAGTGGCCCCAGTGGG - Intergenic
1158527011 18:58224001-58224023 GTCCTCCCTGTGGCCCCTGTGGG - Intronic
1160212745 18:76896162-76896184 GTACCACGTGTGGTCCCTGTGGG - Intronic
1160609402 18:80073745-80073767 GTCCCATTTATGGATCCAGTTGG + Intronic
1162401699 19:10450681-10450703 GCCCCCCTTGCTGCCCCAGTGGG + Intronic
1162802823 19:13120319-13120341 GCCCCACTTTGGCCCCCAGTCGG + Intronic
1163115579 19:15187098-15187120 GTCCCACCTGTGGTCCCAGAAGG + Exonic
1163171311 19:15533019-15533041 CTCCCAGGTGTGGCCCCAGGAGG - Intronic
1165555631 19:36629446-36629468 GTCTCATTTGTGGTACCAGTTGG - Intergenic
1166566154 19:43766884-43766906 GGCCCACCTGAGGCCCCAGGTGG - Exonic
1168516253 19:57012698-57012720 GTCCCACTTAGGACCCCATTGGG + Intergenic
1168691939 19:58382552-58382574 ATCCCACTTGTGTCCCAATTGGG - Intergenic
926087130 2:10027570-10027592 CTCCCACCAGTGGCCCAAGTGGG - Intergenic
926166296 2:10523646-10523668 GTCCCACCTGTGCCTCCAGAGGG - Intergenic
927006054 2:18850340-18850362 GCCCCACTTTGGGCCCCAGCAGG - Intergenic
927711786 2:25330706-25330728 GTCCCAGCTGTGGTCCCACTGGG + Intronic
932570580 2:72936391-72936413 GTCATCCTTTTGGCCCCAGTGGG + Intergenic
934098403 2:88628082-88628104 GTCCTACTTGTGGCCGCAACGGG + Intergenic
934109235 2:88726284-88726306 GTCCAACTCGTGGCCCAAGATGG + Intronic
935736131 2:106107898-106107920 GTCCCACCTGAGGCCCAACTGGG + Intronic
939482139 2:142762222-142762244 GTCCCAGTGGTGGCAACAGTGGG - Intergenic
940372409 2:152918053-152918075 GCCCCACATGTGGCTCCAGTGGG + Intergenic
942851564 2:180494171-180494193 GTTCCAGTTGTGGCATCAGTGGG + Intergenic
1168904228 20:1391234-1391256 GTCCCAATCTTTGCCCCAGTTGG + Intronic
1170698717 20:18684098-18684120 GACCCTCATGTGGCTCCAGTAGG - Intronic
1171097170 20:22343471-22343493 GGCCCACCTCTGGCCCCAGAAGG + Intergenic
1171446093 20:25205809-25205831 GTCCCGCCTGTGGCCACAGCTGG - Intronic
1172049411 20:32105258-32105280 GTCCCACTTGTTGCCCAAGCTGG - Intergenic
1172170662 20:32929855-32929877 GTCACACCTGTGGCCCATGTGGG - Intronic
1176008416 20:62879446-62879468 GTCCCACTCCTTGCCCCGGTCGG + Exonic
1176285237 21:5015928-5015950 GCCACACTTGTGGCCCCTGCAGG + Intergenic
1177464506 21:21458188-21458210 GTCCCAGCTGTGGCCCCACTGGG + Intronic
1178997609 21:37419080-37419102 GACCCACTTGTAGCACCACTTGG + Intronic
1179871944 21:44247547-44247569 GCCACACTTGTGGCCCCTGCAGG - Intronic
1181029405 22:20142669-20142691 GTGCCATGTGTGGCCCCCGTGGG + Intronic
1181460962 22:23085742-23085764 ACCCCACTTGTGTCCCCAGGAGG + Intronic
1182492734 22:30684140-30684162 GCCCCACTATTGGCCCCAGGAGG - Intergenic
1182702230 22:32249824-32249846 GTCCAACCTGTGGCCCAAGCTGG + Intronic
952355448 3:32579125-32579147 GCTCCACCTGCGGCCCCAGTGGG + Intergenic
953992952 3:47498058-47498080 GTCCCATTTGTGACCAAAGTGGG - Intronic
954107792 3:48418657-48418679 CTCCAACTTGTGGCCCCATGGGG - Intronic
954415731 3:50392417-50392439 GTCCCACTGGTGTCCCAGGTAGG - Intronic
954944143 3:54403158-54403180 GTCTCACTTGTTGCCCAAGCTGG - Intronic
954990065 3:54832965-54832987 TTCCCACTGATGGCACCAGTTGG - Intronic
956415809 3:69027778-69027800 GTCCAACCTGTGGCCCTGGTTGG - Intronic
956834970 3:73089332-73089354 GTCCCAGTTGTGTCCCCACTGGG - Intergenic
958827030 3:99042353-99042375 GTCACAATTGTGGCAGCAGTGGG - Intergenic
961355948 3:126340107-126340129 GTCCCAGCTGTGCCCACAGTGGG - Intergenic
961563470 3:127747009-127747031 GACCCACTTGTGACCTCAGGTGG - Intronic
962592599 3:136906460-136906482 GCCCCAGTGGTGGCACCAGTGGG + Intronic
964995053 3:162868485-162868507 GACCCACTTGTGGCCTAACTGGG + Intergenic
965477562 3:169176209-169176231 GTCCAACCTGTGGCCCAAGATGG - Intronic
967774636 3:193374017-193374039 GCAGCACTTGTGGCTCCAGTGGG + Intronic
969497769 4:7535726-7535748 CTCACACGTGTGGCCCCAGTGGG + Intronic
973543990 4:51961975-51961997 GGCCCTGTAGTGGCCCCAGTTGG + Intergenic
977206596 4:94170255-94170277 GCTCCACCTGCGGCCCCAGTAGG + Intergenic
977558322 4:98506916-98506938 ATTCCACTGGTGGCCTCAGTAGG + Intronic
981454099 4:144933646-144933668 GTCTCTCTTGGGGCCCCAGCTGG - Intergenic
982177997 4:152724836-152724858 CTCCCACTGCTTGCCCCAGTTGG + Intronic
984054388 4:174908856-174908878 GTGCCAATTGTGTCCACAGTAGG + Intronic
985577753 5:681612-681634 GCCCCACTTGTGGTCCCATAGGG - Intronic
986667635 5:10117113-10117135 CTCCCACAGGTGGCCCCAGCTGG - Intergenic
987057646 5:14210055-14210077 GCCCTAGTTGTGGCCCCAGCTGG - Intronic
987732854 5:21799926-21799948 GTCCCACTTTTGGACTCACTAGG - Intronic
988262567 5:28907801-28907823 GTCTCACCTGTTGCCCCAGCTGG + Intergenic
988291696 5:29296441-29296463 GCTCCACCTGCGGCCCCAGTGGG - Intergenic
1002681562 5:180969432-180969454 GCTCCACTTGTGGCCCCTGCAGG - Intergenic
1003279460 6:4679112-4679134 CTCCCAGGTGTGGCCCCAGGAGG + Intergenic
1008063240 6:47020472-47020494 GTCACTCTTGTCGCCCAAGTTGG - Intronic
1009939988 6:70280485-70280507 GTACCCCCTCTGGCCCCAGTGGG + Intronic
1010595266 6:77755139-77755161 GTACCACTTGTTGCCCAGGTTGG - Intronic
1013733297 6:113196174-113196196 GTCTCACTTATTGCCCCAGCTGG + Intergenic
1016858728 6:148697141-148697163 GCTCCACCTGTGGCCCCGGTGGG - Intergenic
1017018369 6:150119415-150119437 GTCCCTCCTGTGGTCCCAGCTGG - Intergenic
1018948599 6:168364335-168364357 GGCCCAGTGGTGGCCCCAGAAGG + Intergenic
1019720590 7:2568165-2568187 TTCCCACTTGTGGCCTCATGAGG - Intronic
1022066883 7:26867510-26867532 GTCTCATTTGTGGCCCAAGCTGG - Intronic
1022853563 7:34292517-34292539 GTACCACTTTTTTCCCCAGTAGG + Intergenic
1026653583 7:72237012-72237034 TTCCCTCTTGTTGCCCAAGTTGG + Intronic
1029265760 7:99338764-99338786 GTGCTTCTTGTGGCCCCAGCTGG + Intronic
1031893339 7:127320614-127320636 GTCCCTCTTGATGGCCCAGTGGG + Intergenic
1032427856 7:131835956-131835978 GCTCCACTTGTGGCCCCATCAGG + Intergenic
1032495208 7:132356197-132356219 GACCCACTGGAGGGCCCAGTTGG - Intronic
1032891334 7:136198940-136198962 GTCCCAGTTGTGGCATCAGTGGG + Intergenic
1033654484 7:143363159-143363181 GTCCCAGATGCGGCCCCAGGAGG - Intergenic
1036576498 8:10032182-10032204 GCCCCAGGTGTGGCTCCAGTGGG - Intergenic
1037992112 8:23328464-23328486 GTCCCACTTGTCGTCGCAGACGG + Exonic
1038400125 8:27278249-27278271 GTCTCACTTGTTGCCCAGGTTGG + Intergenic
1041561734 8:59226141-59226163 GGTCCACTTCAGGCCCCAGTTGG - Intergenic
1042168818 8:65973041-65973063 GCCCCACATGTGGCTCCAGTAGG + Intergenic
1043396541 8:79842921-79842943 GTTCCACTTCTGTCCCCGGTTGG - Intergenic
1043464707 8:80493159-80493181 GTCTTGCTTGTCGCCCCAGTTGG - Intronic
1043615058 8:82114994-82115016 GTCCTACCTGTGGCTCCAGCAGG - Intergenic
1043887400 8:85617755-85617777 GTCTCACTTGTGGCCCCGGATGG + Intergenic
1045358337 8:101409516-101409538 GTCCCAGGTGTGGACTCAGTGGG - Intergenic
1046713200 8:117536989-117537011 AGGCCACATGTGGCCCCAGTCGG - Intronic
1049336332 8:142088708-142088730 GTGAAATTTGTGGCCCCAGTGGG + Intergenic
1052968663 9:34363019-34363041 GTACCTCTTCTGGCCCCTGTGGG + Intergenic
1053102347 9:35381404-35381426 GTTCCTCCTGTGGCCCCAGTAGG - Intronic
1053487246 9:38469230-38469252 TTCCCACTTGTCTCCCCTGTTGG + Intergenic
1056488292 9:87081020-87081042 ATCCCATAGGTGGCCCCAGTGGG - Intergenic
1057031056 9:91775535-91775557 CTCCCACCTGTGGCCCCAACAGG + Intronic
1058243810 9:102600305-102600327 GTCCCACTTGAGGAGGCAGTTGG + Intergenic
1061045720 9:128163811-128163833 GGCCCACTCTTGGCCCCAGGAGG - Exonic
1062270615 9:135706656-135706678 GACCCACTTCTGGCCCCTGGAGG - Intronic
1062407147 9:136402292-136402314 GTCACTCTTGTGGCCCCAGTGGG - Exonic
1062555957 9:137113565-137113587 GTCCTCCTTGTGGCACCTGTGGG - Intronic
1186193529 X:7089162-7089184 CTCCCACCTGTGCCCCCAGGTGG - Intronic
1191608745 X:63088844-63088866 GTGCCAGCTGTTGCCCCAGTAGG - Intergenic
1192079565 X:68033517-68033539 GTCCCAGTGGTGGCAGCAGTAGG - Intergenic
1192505539 X:71679929-71679951 GCCCCAGTGGTGGCCACAGTGGG - Intergenic
1194261275 X:91699259-91699281 GTCACACTGGTGGCAACAGTTGG + Intergenic
1194982068 X:100450809-100450831 CTGCCAATTGTGGCCCCTGTGGG + Intergenic
1197435710 X:126425649-126425671 GTCCCAGTTGGTGCCTCAGTAGG + Intergenic
1200579924 Y:4938060-4938082 GTCACACTGGTGGCAACAGTTGG + Intergenic
1201565445 Y:15360683-15360705 CTCCCACTTGTGCCCCCAAGTGG - Intergenic
1201917553 Y:19198646-19198668 GTTCCACTGGGTGCCCCAGTGGG + Intergenic