ID: 1062904494

View in Genome Browser
Species Human (GRCh38)
Location 10:1170685-1170707
Sequence AGCTCTGTGTGGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062904494_1062904505 -4 Left 1062904494 10:1170685-1170707 CCCTCTCCCCTCCACACAGAGCT No data
Right 1062904505 10:1170704-1170726 AGCTGGCTGCATGCGGGGCTGGG No data
1062904494_1062904509 16 Left 1062904494 10:1170685-1170707 CCCTCTCCCCTCCACACAGAGCT No data
Right 1062904509 10:1170724-1170746 GGGAGTTCCAGGAGACAGGGAGG No data
1062904494_1062904510 19 Left 1062904494 10:1170685-1170707 CCCTCTCCCCTCCACACAGAGCT No data
Right 1062904510 10:1170727-1170749 AGTTCCAGGAGACAGGGAGGAGG No data
1062904494_1062904504 -5 Left 1062904494 10:1170685-1170707 CCCTCTCCCCTCCACACAGAGCT No data
Right 1062904504 10:1170703-1170725 GAGCTGGCTGCATGCGGGGCTGG No data
1062904494_1062904503 -9 Left 1062904494 10:1170685-1170707 CCCTCTCCCCTCCACACAGAGCT No data
Right 1062904503 10:1170699-1170721 CACAGAGCTGGCTGCATGCGGGG No data
1062904494_1062904508 13 Left 1062904494 10:1170685-1170707 CCCTCTCCCCTCCACACAGAGCT No data
Right 1062904508 10:1170721-1170743 GCTGGGAGTTCCAGGAGACAGGG No data
1062904494_1062904507 12 Left 1062904494 10:1170685-1170707 CCCTCTCCCCTCCACACAGAGCT No data
Right 1062904507 10:1170720-1170742 GGCTGGGAGTTCCAGGAGACAGG No data
1062904494_1062904506 5 Left 1062904494 10:1170685-1170707 CCCTCTCCCCTCCACACAGAGCT No data
Right 1062904506 10:1170713-1170735 CATGCGGGGCTGGGAGTTCCAGG No data
1062904494_1062904502 -10 Left 1062904494 10:1170685-1170707 CCCTCTCCCCTCCACACAGAGCT No data
Right 1062904502 10:1170698-1170720 ACACAGAGCTGGCTGCATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062904494 Original CRISPR AGCTCTGTGTGGAGGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr