ID: 1062905010

View in Genome Browser
Species Human (GRCh38)
Location 10:1173955-1173977
Sequence CTGGGGGCCCGCAATGCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062905001_1062905010 23 Left 1062905001 10:1173909-1173931 CCGAGCTGACCATGAGGTTGTCT No data
Right 1062905010 10:1173955-1173977 CTGGGGGCCCGCAATGCTTAGGG No data
1062905008_1062905010 -10 Left 1062905008 10:1173942-1173964 CCAGAGAGGAGTGCTGGGGGCCC No data
Right 1062905010 10:1173955-1173977 CTGGGGGCCCGCAATGCTTAGGG No data
1062905002_1062905010 14 Left 1062905002 10:1173918-1173940 CCATGAGGTTGTCTCTTTCACTG No data
Right 1062905010 10:1173955-1173977 CTGGGGGCCCGCAATGCTTAGGG No data
1062905000_1062905010 27 Left 1062905000 10:1173905-1173927 CCTACCGAGCTGACCATGAGGTT No data
Right 1062905010 10:1173955-1173977 CTGGGGGCCCGCAATGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062905010 Original CRISPR CTGGGGGCCCGCAATGCTTA GGG Intergenic
No off target data available for this crispr