ID: 1062907383

View in Genome Browser
Species Human (GRCh38)
Location 10:1187847-1187869
Sequence GGACACATGGGACCACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062907383_1062907387 -9 Left 1062907383 10:1187847-1187869 CCAGGGTGTGGTCCCATGTGTCC 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1062907387 10:1187861-1187883 CATGTGTCCATATGTGCACAGGG No data
1062907383_1062907388 -6 Left 1062907383 10:1187847-1187869 CCAGGGTGTGGTCCCATGTGTCC 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1062907388 10:1187864-1187886 GTGTCCATATGTGCACAGGGAGG No data
1062907383_1062907386 -10 Left 1062907383 10:1187847-1187869 CCAGGGTGTGGTCCCATGTGTCC 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1062907386 10:1187860-1187882 CCATGTGTCCATATGTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062907383 Original CRISPR GGACACATGGGACCACACCC TGG (reversed) Intronic
901430958 1:9214648-9214670 AGGCACATGCCACCACACCCAGG - Intergenic
901950222 1:12739262-12739284 GGACACATGGGCACAAACACGGG + Intergenic
902340618 1:15781212-15781234 AGACACACGCCACCACACCCAGG - Intronic
903039632 1:20519088-20519110 GGACACATGGGCCCAGAATCTGG - Intergenic
903112015 1:21143776-21143798 AGGCACATGCCACCACACCCAGG - Intronic
904370485 1:30044821-30044843 GGAGACATGTGACACCACCCAGG - Intergenic
904533589 1:31184425-31184447 GGGCACATGGGTACACACCCTGG - Intronic
905336047 1:37245276-37245298 GCACACCTGGGACCACACTCAGG - Intergenic
905387710 1:37615683-37615705 GGACACGTGTGAACACACTCGGG - Intronic
905562841 1:38941260-38941282 GGACACTGGAGACCACAGCCAGG - Intronic
905759185 1:40539352-40539374 AGGCACATGCCACCACACCCAGG - Intronic
906380920 1:45331787-45331809 GGAGCCCTGGGACCAGACCCTGG - Exonic
910185848 1:84538941-84538963 AGACACATGCCACCACACCCAGG + Intergenic
910342954 1:86208893-86208915 GGATACATGGGACCAGAGCTGGG - Intergenic
910794759 1:91086612-91086634 GGACACATGGGCCCAAATTCTGG - Intergenic
912632806 1:111261760-111261782 GGACAAATGGGATCATATCCAGG - Intergenic
913176254 1:116275785-116275807 GGACACATGGGGAAACACCCTGG - Intergenic
915064494 1:153213462-153213484 AGGCACATGCCACCACACCCAGG - Intergenic
916584898 1:166142008-166142030 GGACACCTGGGACCTCTCACAGG - Intronic
917386714 1:174484402-174484424 GGACAAATGGGATCACATCAAGG - Intronic
920337979 1:205257690-205257712 AGACACAAGCGACCACAACCAGG - Intronic
1062907383 10:1187847-1187869 GGACACATGGGACCACACCCTGG - Intronic
1063091824 10:2872488-2872510 GCCCACGTGGGACCACAACCAGG + Intergenic
1064405653 10:15059660-15059682 AGGCACATGCCACCACACCCGGG - Intronic
1064973296 10:21088182-21088204 GGACACAGTGTACCACATCCTGG + Intronic
1065343650 10:24727710-24727732 AGGCACATGCCACCACACCCGGG + Intergenic
1065891601 10:30126070-30126092 GGATTCATGGGACCACACCCAGG + Intergenic
1066044927 10:31586645-31586667 GGACAGATGGGAACTCATCCAGG + Intergenic
1066798379 10:39152944-39152966 GGACATATGGGAGCACACTGAGG + Intergenic
1068672991 10:59742870-59742892 AGGCACATGCAACCACACCCAGG + Intergenic
1069558572 10:69413810-69413832 GGACACATGAAAACACACCTGGG - Intronic
1070515397 10:77200826-77200848 GTATACATGTGATCACACCCAGG + Intronic
1070799193 10:79235171-79235193 GGACACCTGGGACCACACTGGGG + Intronic
1070802868 10:79253848-79253870 GCACACATGGCCCCACACACAGG + Intronic
1071357092 10:84808880-84808902 GGACACATGGGCCCAGATTCTGG + Intergenic
1073425080 10:103451375-103451397 GAGGACATGGGGCCACACCCTGG - Intronic
1073438322 10:103535854-103535876 GGACCCATGGCAACTCACCCCGG + Intronic
1076549284 10:131267588-131267610 GGACTCATGGGACCAGCCCCAGG - Intronic
1076731194 10:132440002-132440024 GCACACATGCGTCCACACGCAGG - Intergenic
1077927032 11:6691364-6691386 GGACACATGGGCCCAGATTCTGG - Intergenic
1078751389 11:14167749-14167771 GGACACATGGGCCCAGATTCTGG + Intronic
1079027968 11:16963685-16963707 GGACACTTGTGGCCACACCCTGG - Intronic
1081669882 11:44937021-44937043 GGACAATTGGGTCCAGACCCTGG - Intronic
1083146006 11:60759433-60759455 GGAAACCTTGGACAACACCCAGG - Intronic
1083504286 11:63141039-63141061 GGACACATGGGCCCAGATTCTGG - Intronic
1084511227 11:69605581-69605603 GGACATAAGGGACCACATCAGGG - Intergenic
1084799696 11:71535026-71535048 GGAAACCTTGGACCATACCCAGG - Intronic
1086552549 11:88069333-88069355 GGCCACGTGGGAGCCCACCCTGG - Intergenic
1087212569 11:95458692-95458714 TGACACAGGGAACCAGACCCAGG + Intergenic
1088767576 11:112998573-112998595 GGATAGATGGGACCATAACCTGG - Intronic
1089157093 11:116410753-116410775 AGGCACATGCCACCACACCCTGG + Intergenic
1089657421 11:119960824-119960846 GGAAACATTGGATCCCACCCAGG + Intergenic
1089733210 11:120532343-120532365 CGACTCCTGGGTCCACACCCAGG - Intronic
1090361834 11:126178101-126178123 AGGCACATGCCACCACACCCCGG + Intergenic
1091747785 12:3003701-3003723 GGACAGATGGGCCCACAGTCTGG + Intronic
1096127551 12:49130982-49131004 GGACTCGAGGGACCGCACCCAGG + Intronic
1096567530 12:52493747-52493769 GGACACAAGGGAGGACAGCCAGG - Intergenic
1103700079 12:122844688-122844710 GGACACATGTGACCGCCCCGGGG - Intronic
1105420628 13:20248702-20248724 GGACACAAGGAACCACAGTCAGG - Intergenic
1106173495 13:27308896-27308918 TGAAAAATGGGATCACACCCGGG + Intergenic
1106346337 13:28882591-28882613 AGAAACATGTCACCACACCCAGG - Intronic
1106546513 13:30735394-30735416 GGACACACTGAACCACAGCCAGG + Intronic
1107818494 13:44265687-44265709 GGACAAATGGGACCTAAACCAGG + Intergenic
1108525339 13:51281188-51281210 GGAGACATGCCACCACCCCCAGG + Exonic
1109511307 13:63378502-63378524 AGGCACATGCCACCACACCCAGG + Intergenic
1110529868 13:76583450-76583472 GGGCACACACGACCACACCCGGG - Intergenic
1113700670 13:112385052-112385074 GGACACATGGGCCCAAATTCTGG + Intronic
1113778419 13:112962009-112962031 TTACACATGGGCTCACACCCAGG + Intronic
1114214191 14:20643511-20643533 AGGCACATGCCACCACACCCGGG + Intergenic
1116872347 14:50080371-50080393 GGGCACCTGCCACCACACCCGGG + Intergenic
1118191226 14:63582466-63582488 AGGCACATGCCACCACACCCGGG + Intergenic
1118436525 14:65776151-65776173 GGACCCCTGAGTCCACACCCAGG + Intergenic
1118605376 14:67499144-67499166 AGGCACATGGCACAACACCCAGG + Intronic
1119775633 14:77246672-77246694 GGACACATGGGAGTACTCACTGG - Exonic
1120205033 14:81578941-81578963 AGGCACATGCCACCACACCCAGG - Intergenic
1122034614 14:98938261-98938283 GGCCACACTGGACCACACTCAGG + Intergenic
1122273005 14:100576713-100576735 GGGCAAATGGGACCTCATCCAGG - Intronic
1122689570 14:103525559-103525581 GGAAACCTTGGACAACACCCAGG + Intergenic
1125988741 15:44083706-44083728 GGACACATGGGATCAAACTATGG + Intronic
1127133124 15:55889088-55889110 GGACAAATGGGATCACATCAAGG + Intronic
1128114251 15:65095326-65095348 GGGCACAAGGGACGGCACCCAGG - Intronic
1130977562 15:88789077-88789099 AGGCACATGGGACCAAATCCAGG - Intergenic
1131914498 15:97250012-97250034 GGACACATGGGCCCAGATTCTGG + Intergenic
1132649269 16:1013143-1013165 GGACACACGTGTGCACACCCAGG + Intergenic
1132649272 16:1013164-1013186 GGACACATGCGTGCACACCCAGG + Intergenic
1132649275 16:1013185-1013207 GGACACATGCACGCACACCCAGG + Intergenic
1132649286 16:1013286-1013308 GGACACACGAGTGCACACCCAGG + Intergenic
1133707261 16:8366611-8366633 GGAAACCTGGGACACCACCCAGG - Intergenic
1134129019 16:11635879-11635901 GGGCACATGGGGCCAGACTCGGG + Intronic
1135008996 16:18856304-18856326 AGGCACATGCCACCACACCCAGG + Intronic
1135182089 16:20283983-20284005 GGACAAATGGGATCACATCAAGG + Intergenic
1135825964 16:25729147-25729169 GGATAGATGGGACCCCACTCAGG + Intronic
1136495873 16:30643686-30643708 AGGCACATGCCACCACACCCGGG - Intergenic
1136522734 16:30807507-30807529 GGACACATGCCACCACATCTGGG + Intergenic
1137578718 16:49620871-49620893 GGGCACATGGCACCTCACCCTGG - Intronic
1138816519 16:60209376-60209398 AGGCACATGCCACCACACCCAGG - Intergenic
1139674117 16:68511229-68511251 GCACAGATGGAAACACACCCAGG - Intergenic
1141282216 16:82639054-82639076 AGACGCATGGGTCCAAACCCTGG - Intronic
1143121300 17:4608853-4608875 GGACACGTGGGACCCCACAAAGG - Intergenic
1144753360 17:17665231-17665253 AGGCACATGCCACCACACCCGGG - Intergenic
1145844755 17:28028898-28028920 GGGCACATGCCACCACACCTGGG - Intergenic
1146090890 17:29876547-29876569 GGACAAATGGGATCACATCAAGG - Intronic
1146090921 17:29876860-29876882 GGACAAATGGGATCACATCAAGG + Intronic
1146615890 17:34357189-34357211 GCAGATCTGGGACCACACCCAGG + Intronic
1146627174 17:34443700-34443722 GGACACACGGTATCACACACAGG - Intergenic
1148973732 17:51508301-51508323 CGACACATGGGGGCACTCCCCGG + Intergenic
1150371857 17:64645748-64645770 AGACATATGCCACCACACCCAGG + Intronic
1152520220 17:80851681-80851703 GGACACTCGGGACCACATCACGG + Intronic
1153800351 18:8663033-8663055 GGACAGATGGGAGCTCACCGCGG - Intergenic
1156232623 18:35169212-35169234 AGGCACATGCCACCACACCCGGG + Intergenic
1158993036 18:62889634-62889656 GGGCACATGGGTGCACACACTGG + Intronic
1160542058 18:79629250-79629272 TGGCACGGGGGACCACACCCGGG + Intergenic
1160972653 19:1776304-1776326 GGACACGGGAGACCACGCCCAGG + Exonic
1162472470 19:10880692-10880714 GGGCTCATGGGACCGCCCCCAGG - Intronic
1162613944 19:11780377-11780399 AGACACATGGCAGCACACCATGG + Exonic
1164361859 19:27521598-27521620 GGACACATGGGAACCCACAAAGG + Intergenic
1164634343 19:29781630-29781652 GGGCACGTGGGCCCACACGCGGG + Intergenic
1165257830 19:34590252-34590274 GGACACCTGGGACCTCCTCCAGG - Intergenic
1167584435 19:50365631-50365653 GGACACCTGGGTTCACACCCAGG - Exonic
1168661759 19:58172855-58172877 GGACAGATGTGACCACACATAGG - Intergenic
926082118 2:9995665-9995687 GCAGACATGGGACCACACTCAGG - Intronic
926573174 2:14552127-14552149 GGGCACATGCCACCACACCCAGG - Intergenic
927717362 2:25361331-25361353 GGGCACGTGCCACCACACCCGGG + Intergenic
929767032 2:44853364-44853386 GAAGACAAGGGACCAGACCCTGG + Intergenic
930778928 2:55203802-55203824 GGACAAATGGGATCACATCAAGG + Intronic
932773314 2:74513603-74513625 GGACACGTGGGACCTCACTGAGG - Intronic
935744076 2:106175769-106175791 TGATGCCTGGGACCACACCCAGG - Intronic
936341967 2:111641801-111641823 TGACACATGGGTGCTCACCCTGG - Intergenic
937015889 2:118605058-118605080 AGTCACATGGGACCTAACCCAGG + Intergenic
937390291 2:121480189-121480211 GGTCAAATGGGACGACACCGGGG + Intronic
937467942 2:122151411-122151433 ATGCACATGGGAGCACACCCCGG + Intergenic
938078744 2:128357800-128357822 GGACACAGGGGCCCACACCTTGG - Intergenic
938248576 2:129797024-129797046 GGCCTCATGGGGCCACACCAAGG + Intergenic
942463043 2:176182594-176182616 GGACACATATGAACACACACAGG - Intergenic
942601099 2:177642010-177642032 AGAGACCTGGGACCAAACCCTGG - Intronic
943611262 2:190037730-190037752 GTAGACATGGGATCACACCATGG - Intronic
946705627 2:222455933-222455955 AGACACATGTCACCACACCCGGG - Intronic
947796805 2:232898295-232898317 AGACACCTGGGATGACACCCTGG + Intronic
948517355 2:238512085-238512107 GGAAAGATGGGGCCACAGCCAGG + Intergenic
948571003 2:238917009-238917031 GGACACCTGGGTCCACACACCGG - Intergenic
1170191521 20:13649622-13649644 TGAGACCTGGGAACACACCCAGG + Intergenic
1172460802 20:35116931-35116953 AGGCACATGCCACCACACCCAGG + Intronic
1172645321 20:36465532-36465554 GAACAGATGGGAACAGACCCAGG - Intronic
1173424954 20:42934519-42934541 CTTCAGATGGGACCACACCCTGG - Intronic
1173569344 20:44066641-44066663 GGACACATGGGCTCTCACCCCGG + Intronic
1174412516 20:50345201-50345223 TGACATATGGGAACACAGCCTGG + Intergenic
1174586053 20:51609180-51609202 GGAAAGATGGGACCAGACCACGG + Intronic
1174649515 20:52112756-52112778 AGGCACATGCCACCACACCCAGG + Intronic
1175947793 20:62566746-62566768 GGACTCAGGGAACCACTCCCGGG + Intronic
1176055013 20:63140787-63140809 GAGCCCATGGGACCACAGCCCGG + Intergenic
1176107158 20:63394858-63394880 GGACCCCGGGCACCACACCCAGG - Intergenic
1176247431 20:64104170-64104192 GCACACCTGGGACCAACCCCTGG + Intergenic
1176457725 21:6928458-6928480 GCACAGCTGGGGCCACACCCAGG - Intergenic
1176835897 21:13793542-13793564 GCACAGCTGGGGCCACACCCAGG - Intergenic
1178758533 21:35377587-35377609 GGAGAACTGGGACCAGACCCGGG - Intronic
1179996601 21:44977203-44977225 GCACAGCTGGGGCCACACCCAGG - Intergenic
1181483905 22:23218714-23218736 GGACCCATGGGGCTTCACCCAGG + Intronic
1182421964 22:30252981-30253003 GCACACACGGGACCAGACACAGG - Intergenic
1183093629 22:35540102-35540124 GGACACCTGGGAGGGCACCCGGG + Intergenic
950578909 3:13850353-13850375 GGACACCAGGGACCAGCCCCTGG - Intronic
951890690 3:27565326-27565348 GGACACAGGAGTCCACTCCCTGG + Intergenic
952209258 3:31212755-31212777 AGGCACATGCCACCACACCCAGG - Intergenic
952732455 3:36653206-36653228 GGACACATGGAAGCACAGCAAGG + Intergenic
953233836 3:41088561-41088583 TGACACAGGGGACCACACAGCGG + Intergenic
953972258 3:47356429-47356451 GGACCCGGGGGACCACACCGGGG + Intergenic
954363230 3:50133361-50133383 GGACACTGGGGATCAGACCCTGG + Intergenic
955324695 3:58000884-58000906 GGACTCCTGGGGCCCCACCCTGG + Intergenic
956973313 3:74551905-74551927 AGGCACATGTCACCACACCCCGG + Intergenic
960234326 3:115264119-115264141 GGAGAGAGGGGACCACAGCCAGG - Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961774017 3:129271168-129271190 AGGCCCATGGGACCCCACCCTGG - Intronic
962427582 3:135285640-135285662 GGACACATGGGCCCAGATTCTGG + Intergenic
963990924 3:151652795-151652817 AGACACATGCCACCACACCCAGG - Intergenic
964435864 3:156652635-156652657 GGACACAGGAGATCACACTCTGG - Intergenic
968661149 4:1799334-1799356 GGCCCCATGGGACCACCCCCGGG - Exonic
969605703 4:8201350-8201372 GGAGACGTGGGGCCAAACCCCGG - Intronic
974026424 4:56737206-56737228 AGGCACATGCCACCACACCCGGG - Intergenic
976255696 4:83098350-83098372 GGACACATGGGCCCAGATTCTGG - Intronic
976453330 4:85217534-85217556 GGACAAATGGGACCACATCAAGG - Intergenic
977600097 4:98926801-98926823 GAACACTTGGTACAACACCCTGG + Intronic
979089280 4:116459527-116459549 GGTCTCAAGGGAGCACACCCTGG + Intergenic
980014652 4:127635286-127635308 TGACACATGGGCACATACCCTGG + Intronic
983501066 4:168500343-168500365 AGACTTATGGGACCACCCCCTGG - Intronic
983881586 4:172939150-172939172 AGGCACATGCCACCACACCCAGG - Intronic
985032521 4:185804213-185804235 AGTCACATGGAACCACACGCAGG + Intronic
987861570 5:23493594-23493616 AGACACATGCCACCATACCCAGG + Intergenic
991446240 5:66702988-66703010 GGCCAGATGGGACCAGAACCTGG + Intronic
994010977 5:94901824-94901846 GGACTCATACGAACACACCCAGG - Intronic
996258996 5:121442382-121442404 GGACAAATGGGATCACACTAAGG + Intergenic
998143630 5:139713261-139713283 CCACAGATGAGACCACACCCAGG - Intergenic
998848854 5:146336023-146336045 AAACACATGGGACCAGACACAGG + Intronic
999873599 5:155777498-155777520 AGGCACATGCCACCACACCCTGG + Intergenic
1000920380 5:167130629-167130651 GGCCATGTGGGTCCACACCCAGG + Intergenic
1001741229 5:174054524-174054546 AGGCACATGCTACCACACCCAGG + Intronic
1002587363 5:180258022-180258044 AGACACATGGTAACACACACTGG + Intronic
1006055023 6:31377780-31377802 GGCCCCATGGGACCACCTCCAGG - Intergenic
1006820988 6:36894638-36894660 GGACACTTGGGTTCACATCCTGG + Intronic
1008498332 6:52155003-52155025 TGACTCACCGGACCACACCCAGG + Intergenic
1010211300 6:73364306-73364328 GGGCACACCGGACCACAGCCGGG - Intergenic
1010824254 6:80453501-80453523 AGACACATAGGACCACACTGTGG - Intergenic
1013014559 6:106149638-106149660 GGTCACATCAGACCACATCCAGG + Intergenic
1013075511 6:106767313-106767335 AGGCACATGCCACCACACCCAGG - Intergenic
1015763644 6:136692183-136692205 GGGAACATGCCACCACACCCAGG + Intronic
1015882314 6:137881490-137881512 GGCCACCTGGGAACACTCCCGGG - Exonic
1016741957 6:147538137-147538159 GGACACATGGGCCCAGATTCTGG + Intronic
1018802060 6:167230932-167230954 GGACACGTGGGCCCAGACGCTGG - Intergenic
1019287813 7:232287-232309 GGACACATGGGAGAACAGACAGG - Intronic
1020031083 7:4933216-4933238 AGGCACATGCCACCACACCCAGG - Intronic
1023831451 7:44040861-44040883 GGACACAGGGGACAATACACGGG + Intergenic
1024572553 7:50735558-50735580 AGACACATGGGCCCACATTCTGG - Intronic
1025213180 7:57033056-57033078 GGACAGATGGGACCAGAGTCAGG - Intergenic
1025593089 7:62888501-62888523 GGACACATGGGAGCTCACTGAGG + Intergenic
1025658773 7:63543768-63543790 GGACAGATGGGACCAGAGTCAGG + Intergenic
1026936720 7:74260910-74260932 AGGCACATGCCACCACACCCAGG - Intergenic
1029416386 7:100445839-100445861 AGGCACATGCCACCACACCCAGG + Intergenic
1029683391 7:102128326-102128348 GGACAGATGGGACCAGAGTCAGG - Intronic
1029741775 7:102495163-102495185 GGACACAGGGGACAATACACGGG + Intronic
1029759766 7:102594332-102594354 GGACACAGGGGACAATACACGGG + Intronic
1029777128 7:102690242-102690264 GGACACAGGGGACAATACACGGG + Intergenic
1029856100 7:103518474-103518496 AGGCACATGCCACCACACCCAGG + Intronic
1036446002 8:8822411-8822433 GGAGACAGGGGACCACGCCAGGG + Intronic
1037817272 8:22118861-22118883 GAGCACATGGGACCGCACACTGG + Intronic
1044317683 8:90768826-90768848 GGAGACATGAGACCATATCCTGG + Intronic
1045880974 8:107040155-107040177 AGACACAAGCCACCACACCCAGG + Intergenic
1047287878 8:123503933-123503955 AGGCACATGCCACCACACCCAGG - Intronic
1047439490 8:124864395-124864417 GGAAAGATGGAACCACACCTGGG + Intergenic
1047934651 8:129764913-129764935 GGACAAATGGTAACAGACCCTGG - Intronic
1050044781 9:1531520-1531542 GGACACATGGGCCAACTTCCAGG + Intergenic
1050289856 9:4142514-4142536 GAACACAGGAGACCACATCCTGG - Intronic
1051630022 9:19132349-19132371 GGACAGATGCCACCACCCCCAGG + Intronic
1053069714 9:35093965-35093987 GGCCACAGTGGTCCACACCCAGG + Exonic
1053441207 9:38117828-38117850 GCACACACGTGAGCACACCCAGG - Intergenic
1057681320 9:97188464-97188486 AGGCACATGCAACCACACCCAGG - Intergenic
1058632694 9:107006163-107006185 CAACCCATGGAACCACACCCTGG - Intronic
1059797711 9:117717014-117717036 TGAGACATGGAAACACACCCAGG - Intergenic
1061204446 9:129154937-129154959 GGATACCTGGGACAACACCCAGG + Intergenic
1188686868 X:33080173-33080195 GGACACATGGGCCCAGATTCTGG + Intronic
1189037507 X:37507304-37507326 GGACACATGCAACCATCCCCAGG - Intronic
1189343834 X:40225340-40225362 AGGCACATGCTACCACACCCGGG + Intergenic
1192085322 X:68090645-68090667 GGCCAAATGGGACCTCATCCAGG - Intronic
1192872381 X:75196307-75196329 AGGCACATGCTACCACACCCAGG + Intergenic
1193309955 X:79994900-79994922 AGACACATGGGACTACATCAAGG + Intergenic
1196421573 X:115527626-115527648 AGACACATGCCACCACACCCAGG - Intergenic
1197656238 X:129119157-129119179 GGGGACATGGGACCACACGTGGG + Intergenic