ID: 1062909525

View in Genome Browser
Species Human (GRCh38)
Location 10:1203813-1203835
Sequence CTTCTCAGTGGACCTCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062909522_1062909525 11 Left 1062909522 10:1203779-1203801 CCTTGACCGTTCTCTTGCTGCTC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1062909525 10:1203813-1203835 CTTCTCAGTGGACCTCAAAGTGG No data
1062909521_1062909525 12 Left 1062909521 10:1203778-1203800 CCCTTGACCGTTCTCTTGCTGCT 0: 1
1: 0
2: 0
3: 6
4: 155
Right 1062909525 10:1203813-1203835 CTTCTCAGTGGACCTCAAAGTGG No data
1062909523_1062909525 5 Left 1062909523 10:1203785-1203807 CCGTTCTCTTGCTGCTCTGAGCG 0: 1
1: 0
2: 2
3: 25
4: 276
Right 1062909525 10:1203813-1203835 CTTCTCAGTGGACCTCAAAGTGG No data
1062909520_1062909525 15 Left 1062909520 10:1203775-1203797 CCTCCCTTGACCGTTCTCTTGCT 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1062909525 10:1203813-1203835 CTTCTCAGTGGACCTCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062909525 Original CRISPR CTTCTCAGTGGACCTCAAAG TGG Intronic
No off target data available for this crispr