ID: 1062910352

View in Genome Browser
Species Human (GRCh38)
Location 10:1208292-1208314
Sequence GGATGTTCCCCCAGTTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062910348_1062910352 1 Left 1062910348 10:1208268-1208290 CCACAGTGGGGTGGCTTGAAACA 0: 1
1: 0
2: 0
3: 20
4: 178
Right 1062910352 10:1208292-1208314 GGATGTTCCCCCAGTTCTGGAGG No data
1062910339_1062910352 29 Left 1062910339 10:1208240-1208262 CCAGCCTCCTAGGGCTGCTGTGG 0: 1
1: 0
2: 18
3: 131
4: 834
Right 1062910352 10:1208292-1208314 GGATGTTCCCCCAGTTCTGGAGG No data
1062910342_1062910352 25 Left 1062910342 10:1208244-1208266 CCTCCTAGGGCTGCTGTGGGACA 0: 1
1: 0
2: 3
3: 29
4: 248
Right 1062910352 10:1208292-1208314 GGATGTTCCCCCAGTTCTGGAGG No data
1062910343_1062910352 22 Left 1062910343 10:1208247-1208269 CCTAGGGCTGCTGTGGGACAACC 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1062910352 10:1208292-1208314 GGATGTTCCCCCAGTTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062910352 Original CRISPR GGATGTTCCCCCAGTTCTGG AGG Intronic
No off target data available for this crispr