ID: 1062910990

View in Genome Browser
Species Human (GRCh38)
Location 10:1212425-1212447
Sequence CACAAGTACCTTCTTGCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062910984_1062910990 30 Left 1062910984 10:1212372-1212394 CCTGCCTTAGCAGGTACATCCTG No data
Right 1062910990 10:1212425-1212447 CACAAGTACCTTCTTGCCAAAGG No data
1062910988_1062910990 11 Left 1062910988 10:1212391-1212413 CCTGGTCTATGCTCAGGTCTGAT 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1062910990 10:1212425-1212447 CACAAGTACCTTCTTGCCAAAGG No data
1062910986_1062910990 26 Left 1062910986 10:1212376-1212398 CCTTAGCAGGTACATCCTGGTCT 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1062910990 10:1212425-1212447 CACAAGTACCTTCTTGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062910990 Original CRISPR CACAAGTACCTTCTTGCCAA AGG Intronic
No off target data available for this crispr