ID: 1062919145

View in Genome Browser
Species Human (GRCh38)
Location 10:1266171-1266193
Sequence CGTGTGGGTCGGCGCCGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062919133_1062919145 28 Left 1062919133 10:1266120-1266142 CCAGGTCCACGCTCTCCCGGAAG No data
Right 1062919145 10:1266171-1266193 CGTGTGGGTCGGCGCCGAGAAGG No data
1062919136_1062919145 13 Left 1062919136 10:1266135-1266157 CCCGGAAGACACGGTCCACGCCC No data
Right 1062919145 10:1266171-1266193 CGTGTGGGTCGGCGCCGAGAAGG No data
1062919137_1062919145 12 Left 1062919137 10:1266136-1266158 CCGGAAGACACGGTCCACGCCCT No data
Right 1062919145 10:1266171-1266193 CGTGTGGGTCGGCGCCGAGAAGG No data
1062919139_1062919145 -2 Left 1062919139 10:1266150-1266172 CCACGCCCTCTGAGAAGATGGCG No data
Right 1062919145 10:1266171-1266193 CGTGTGGGTCGGCGCCGAGAAGG No data
1062919140_1062919145 -7 Left 1062919140 10:1266155-1266177 CCCTCTGAGAAGATGGCGTGTGG No data
Right 1062919145 10:1266171-1266193 CGTGTGGGTCGGCGCCGAGAAGG No data
1062919142_1062919145 -8 Left 1062919142 10:1266156-1266178 CCTCTGAGAAGATGGCGTGTGGG No data
Right 1062919145 10:1266171-1266193 CGTGTGGGTCGGCGCCGAGAAGG No data
1062919134_1062919145 22 Left 1062919134 10:1266126-1266148 CCACGCTCTCCCGGAAGACACGG No data
Right 1062919145 10:1266171-1266193 CGTGTGGGTCGGCGCCGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062919145 Original CRISPR CGTGTGGGTCGGCGCCGAGA AGG Intronic