ID: 1062919304

View in Genome Browser
Species Human (GRCh38)
Location 10:1267159-1267181
Sequence CACCCACACCTACCCGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062919304_1062919311 7 Left 1062919304 10:1267159-1267181 CCCCTCCCGGGTAGGTGTGGGTG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1062919311 10:1267189-1267211 CTGCAGAGAAAATGTGAGGCAGG No data
1062919304_1062919310 3 Left 1062919304 10:1267159-1267181 CCCCTCCCGGGTAGGTGTGGGTG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1062919310 10:1267185-1267207 GTCACTGCAGAGAAAATGTGAGG No data
1062919304_1062919312 20 Left 1062919304 10:1267159-1267181 CCCCTCCCGGGTAGGTGTGGGTG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1062919312 10:1267202-1267224 GTGAGGCAGGTCAGAAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062919304 Original CRISPR CACCCACACCTACCCGGGAG GGG (reversed) Intronic
901018412 1:6244273-6244295 CCCCCACACCTCCCGGGGAAGGG - Intronic
904311953 1:29634830-29634852 CACCCACACCTATCCAGGTGTGG + Intergenic
907158554 1:52355515-52355537 CAGCCACACCTCCCAGGGATGGG + Intronic
908020645 1:59894495-59894517 CACCCACACATAACAGGGAGTGG - Intronic
910644781 1:89502192-89502214 AACACACACATACCCTGGAGAGG - Intergenic
911723765 1:101220038-101220060 CAGCCACACCTGCCAGGCAGTGG - Intergenic
912855615 1:113166449-113166471 CACACACATCTACCTGGGAAGGG - Intergenic
914846545 1:151286833-151286855 CACCCTCTCCCACTCGGGAGGGG + Exonic
918124831 1:181574119-181574141 TCCCCACACTTACCCGTGAGAGG - Intronic
918282720 1:183022853-183022875 GACCCACACCTGGCCGGGCGGGG + Intergenic
920074050 1:203324226-203324248 CACCCACATCTCCCAGGAAGTGG - Intergenic
920173218 1:204084312-204084334 CCCCCACAGCTGCCTGGGAGAGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1062824196 10:556442-556464 CACCCACACCTTCCCAAGAGGGG + Intronic
1062919304 10:1267159-1267181 CACCCACACCTACCCGGGAGGGG - Intronic
1064161243 10:12948480-12948502 CACACACACACACACGGGAGGGG + Intronic
1069488553 10:68841991-68842013 CACACACACCTCCCTGGGTGCGG - Intronic
1072225980 10:93369245-93369267 CACACACACCAACCCAGGAGAGG - Intronic
1072741987 10:97915111-97915133 CAGCCACAACAACCCGGGTGGGG + Intronic
1072762617 10:98069556-98069578 CACACACACACACACGGGAGGGG - Intergenic
1073323800 10:102631049-102631071 CAACCAGGCCTACCTGGGAGAGG + Exonic
1076320764 10:129579935-129579957 CACCCAGGCCTGCCCGTGAGAGG + Intronic
1076921927 10:133458733-133458755 CACCCACACCTACTGGCCAGAGG - Intergenic
1080116878 11:28631325-28631347 CACCCACACCCAAAGGGGAGGGG + Intergenic
1081672432 11:44949696-44949718 CACTCGCACCTACCCGGGGGAGG - Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1083873535 11:65507347-65507369 AACCCAGACCTACCAGAGAGAGG + Intergenic
1084956311 11:72693503-72693525 CACCAACCCCTACCCGGGGCTGG + Intronic
1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG + Intronic
1085143535 11:74171467-74171489 CGCCCACCTCTACCCGGCAGCGG + Exonic
1089344621 11:117783125-117783147 CACACACTCCTTCCTGGGAGCGG + Intronic
1090384934 11:126352372-126352394 CACCCACTCCTGCCAGAGAGGGG + Intergenic
1091209400 11:133843629-133843651 CAGCCACCCCTTCCCAGGAGAGG - Intronic
1092253425 12:6914104-6914126 CACCCACGCCTGCCCGAGGGCGG - Exonic
1093971130 12:25377096-25377118 CAACCACACCAAGCCTGGAGGGG - Intergenic
1096122118 12:49094873-49094895 CACCCCCTCCCACCCGGGCGGGG + Intergenic
1100061773 12:90587640-90587662 CACACACACATACACGTGAGAGG - Intergenic
1101859934 12:108474831-108474853 CCCCAACACCTACCCGCAAGGGG - Intergenic
1102426881 12:112850686-112850708 CACCCACACTTCCCTGGGAGGGG + Intronic
1106138587 13:26992476-26992498 AACCCACACCTGCCCAGGAAAGG + Intergenic
1106534211 13:30624496-30624518 TAGCCCCAGCTACCCGGGAGGGG + Intronic
1108747326 13:53408984-53409006 CACGCACCCCACCCCGGGAGGGG - Intergenic
1109393965 13:61729937-61729959 CACGCACAATTAGCCGGGAGTGG - Intergenic
1114842607 14:26282851-26282873 CAACCACATATACCAGGGAGAGG + Intergenic
1118315455 14:64723131-64723153 CACCCACACCTACCCTCTGGAGG - Intronic
1122769307 14:104090819-104090841 CACCCACAGGTACCGGGGATTGG + Intronic
1122810512 14:104285407-104285429 CCCCCAGTCCTACCCAGGAGGGG - Intergenic
1123053886 14:105560276-105560298 CACCCACATCCACCCCCGAGGGG + Intergenic
1123078469 14:105680693-105680715 CACCCACATCCACCCCCGAGGGG + Intergenic
1125030239 15:35068776-35068798 CAACCACCCCTACCAGAGAGAGG + Intergenic
1127520480 15:59738792-59738814 CACCCACACCTAGCTGGGTGAGG - Intergenic
1130098712 15:80875722-80875744 CACCCTCACTTTCCCAGGAGGGG - Intronic
1131013889 15:89041791-89041813 CACCCAGACCTGGCCTGGAGGGG + Intergenic
1133172230 16:3988456-3988478 CCCCCACACCTGCCCTGGAAGGG - Intronic
1133172240 16:3988482-3988504 CCCCCACACCTGCCCTGGAAGGG - Intronic
1135149336 16:19991906-19991928 CACTCACAGCTGCCCAGGAGAGG - Intergenic
1135479832 16:22813718-22813740 CCCCCACACCCACGCGGGGGTGG - Intergenic
1136640711 16:31563131-31563153 GACCCACCCTTACCCTGGAGAGG - Intergenic
1139849414 16:69941516-69941538 CACCCTGACCCACCCTGGAGCGG - Exonic
1141699933 16:85637773-85637795 AAGCCACACCTGCCGGGGAGTGG + Intronic
1142073202 16:88102746-88102768 CACCCCCACCTACCCCAGGGAGG - Intronic
1142078136 16:88132192-88132214 CCCCCACCCCTACCCAGGACGGG + Intergenic
1142196877 16:88743067-88743089 CACCCACACCTGGCAGGAAGCGG + Intronic
1144830170 17:18126728-18126750 CTCCCACACCTCCCAGGGATTGG - Intronic
1151227301 17:72656630-72656652 CAGACAGACCTCCCCGGGAGAGG - Intronic
1153480609 18:5543449-5543471 CCCCCGCACCTCCCCGGGGGAGG + Intronic
1153567228 18:6430529-6430551 CAACCCCACCTACCCAGGAAGGG - Intergenic
1154319126 18:13330801-13330823 CACCCCCACCCTCCAGGGAGGGG + Intronic
1154943989 18:21142562-21142584 CACACACAACTACCCGGGCATGG - Intergenic
1159940806 18:74406512-74406534 CACCACCACCTACTTGGGAGTGG + Intergenic
1160066845 18:75583379-75583401 CCCCCTCACCTACCCAGGACTGG - Intergenic
1160246658 18:77165128-77165150 GACCCCCTCCTACCTGGGAGGGG + Intergenic
1161022491 19:2016582-2016604 CCCCCACACCTGGCCTGGAGAGG - Intronic
1161383950 19:3981150-3981172 CACCCACACCTGTCCCGGATGGG + Intronic
1161496914 19:4591497-4591519 CACCCACACTTAGGCGGGTGAGG - Intergenic
1162437604 19:10671549-10671571 CCCACCCACCTACCCGGCAGTGG - Intronic
1162799596 19:13103294-13103316 CCACCACCCCTACCCGGGAGTGG + Intergenic
1165743578 19:38217523-38217545 CACCCACACCCACCTGGCCGAGG - Exonic
1166769381 19:45271768-45271790 CCCCCACACCTCCCCTGCAGAGG + Intronic
925003615 2:425542-425564 CACCCACAGCTACGATGGAGTGG + Intergenic
926249222 2:11144133-11144155 CACCCACACCCACCTGGGGAAGG - Exonic
926901149 2:17753529-17753551 GACCCCCAGCCACCCGGGAGAGG - Intronic
929431448 2:41890793-41890815 CACCCACAGCCTCCAGGGAGGGG + Intergenic
929939579 2:46322905-46322927 CAGCCAAACCTACCCGTCAGTGG + Intronic
931457715 2:62425075-62425097 CACCAGGACCTGCCCGGGAGAGG - Intergenic
931500898 2:62865142-62865164 CACACACACATACCTGGAAGAGG - Intronic
932267440 2:70380331-70380353 CACACACACACACACGGGAGTGG + Intergenic
932824456 2:74926818-74926840 CACCCACACCTACCCTTCACTGG - Intergenic
936112457 2:109676224-109676246 CACTCACACCTTCCAGGGTGTGG - Intergenic
937908635 2:127064761-127064783 CACTCACACCCACCAGGCAGTGG + Intronic
947791395 2:232871286-232871308 CACCCAGACCTCCCAGGGTGTGG - Intronic
948203894 2:236151135-236151157 CCACCACACCTAACTGGGAGAGG - Intergenic
948607516 2:239145550-239145572 TCCCCAAACCCACCCGGGAGAGG + Intronic
1169072091 20:2738964-2738986 CAGCCACCTCTACCCGGGTGGGG + Intronic
1169208678 20:3753946-3753968 CCCCCACACCCACCCCAGAGAGG + Exonic
1172619091 20:36307645-36307667 CACCCCCACCTGCCTGGAAGTGG + Intronic
1172702792 20:36863264-36863286 CACCCGCGCCTGCCCCGGAGAGG - Exonic
1176006694 20:62868370-62868392 CACCAACAATTAGCCGGGAGTGG + Intergenic
1177399802 21:20588002-20588024 CACACACACATACCCAGGAGGGG + Intergenic
1177399857 21:20588392-20588414 CACACACACACACCAGGGAGTGG + Intergenic
1178953414 21:37004157-37004179 CATCCACACCTAGCCAGGCGTGG + Intergenic
1181756598 22:25028808-25028830 CACCCACGTCTTCTCGGGAGGGG - Exonic
1182293431 22:29299322-29299344 AACCTGCACCTACCCGGGGGCGG - Exonic
1183369892 22:37426658-37426680 CACACACACACACCCGGCAGTGG + Intronic
1184423050 22:44392831-44392853 CACCCACTCCTTCTGGGGAGGGG - Intergenic
1185251518 22:49804142-49804164 CACCCCCACCCTCCAGGGAGAGG - Intronic
949157507 3:847242-847264 GACAAACACCTACCCAGGAGCGG - Intergenic
951046359 3:18043272-18043294 CACCCAAAACTAACCGTGAGAGG + Intronic
957711640 3:83867527-83867549 CACACACACACACCAGGGAGAGG + Intergenic
965165854 3:165194137-165194159 CACCAACTCCTCGCCGGGAGGGG + Intronic
966837313 3:184059098-184059120 CACCCACTCCTGCTCTGGAGAGG + Intronic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
968727691 4:2255892-2255914 CACCCCCAGCTCCCCGGCAGCGG - Intronic
985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG + Intronic
986283796 5:6345405-6345427 CAGCCACACGTTCCCAGGAGTGG + Intergenic
991006041 5:61828920-61828942 CACCCACACCTCCCTAGTAGAGG - Intergenic
1002301133 5:178257713-178257735 ACCCCACACCTGCCCTGGAGGGG - Intronic
1003569324 6:7246128-7246150 CACTCACACCTTCCTGGGGGCGG + Intronic
1003873728 6:10419902-10419924 CCCCGACCCCCACCCGGGAGTGG - Intergenic
1004510222 6:16278797-16278819 CACCCGCACCAAGACGGGAGTGG + Exonic
1004906608 6:20242415-20242437 CTCCCCCACCCACCAGGGAGGGG - Intergenic
1005371395 6:25137358-25137380 CACACACACATACCCCAGAGAGG + Intergenic
1006101658 6:31689514-31689536 CACCCAGCCCCACCCGGGAGAGG - Intronic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1020213129 7:6170187-6170209 CAGCCACACCAAACCGAGAGAGG + Intronic
1020714492 7:11653436-11653458 CACACACACATATCTGGGAGTGG - Intronic
1022133542 7:27425830-27425852 CACCCACTCAGACCCTGGAGGGG + Intergenic
1026968474 7:74454385-74454407 GCCCCCCACCTGCCCGGGAGGGG + Intronic
1027484325 7:78741414-78741436 CACACACACACACACGGGAGGGG + Intronic
1028641297 7:93044514-93044536 CACCCAGACCTTCTTGGGAGAGG + Intergenic
1028988075 7:97023328-97023350 CACACACACACACCCTGGAGAGG - Intronic
1032500308 7:132394995-132395017 CAGCCACACCTGCCCCGGAAAGG - Intronic
1035231467 7:157468497-157468519 CACCGTCACCTTCACGGGAGAGG + Intergenic
1037066896 8:14593043-14593065 CAACCACACCTGCCCTGGTGTGG + Intronic
1040530616 8:48263654-48263676 CACCCGCCCCCACCAGGGAGAGG - Intergenic
1049409092 8:142464528-142464550 CACGCGCACCTACCTGGGCGTGG + Exonic
1053278999 9:36805166-36805188 CACCCACACCTCGCTGGGAGTGG - Intergenic
1056331316 9:85523337-85523359 CACCCACACCTGCCCTGGGAGGG - Intergenic
1060732487 9:126047477-126047499 CACCCACACCCACACAGAAGGGG - Intergenic
1060748115 9:126151038-126151060 CACTCCCACCTCCCCAGGAGAGG - Intergenic
1062236912 9:135514796-135514818 CACCCACTCCCACCCCAGAGAGG + Intergenic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1188636372 X:32436794-32436816 CACACACAAATAACCGGGAGTGG + Intronic
1189487039 X:41442264-41442286 CACCCGCACCTACTCGGTGGGGG - Intergenic
1190411497 X:50141013-50141035 CAACCTCACCTACCAGGGAGAGG - Intergenic
1195755945 X:108198810-108198832 CCCACACACCTACCCAGTAGGGG - Intronic
1198506252 X:137303935-137303957 CACCCACACCTACCCTCGCCTGG - Intergenic
1199016910 X:142828321-142828343 GGCCCACACCTACCAGGGAGGGG - Intergenic
1200236356 X:154469607-154469629 CACCCACCCACACCCAGGAGGGG - Intronic
1201758281 Y:17513676-17513698 CACACACACTTTCCCTGGAGGGG - Intergenic
1201843274 Y:18392314-18392336 CACACACACTTTCCCTGGAGGGG + Intergenic