ID: 1062919818

View in Genome Browser
Species Human (GRCh38)
Location 10:1271328-1271350
Sequence CACTGTTTCCATGGGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062919818_1062919829 27 Left 1062919818 10:1271328-1271350 CCAACCTCCCCATGGAAACAGTG 0: 1
1: 0
2: 2
3: 25
4: 227
Right 1062919829 10:1271378-1271400 CAGTGACTGGAGGAGTCTTTCGG No data
1062919818_1062919828 17 Left 1062919818 10:1271328-1271350 CCAACCTCCCCATGGAAACAGTG 0: 1
1: 0
2: 2
3: 25
4: 227
Right 1062919828 10:1271368-1271390 CCTCTCAGAGCAGTGACTGGAGG No data
1062919818_1062919826 14 Left 1062919818 10:1271328-1271350 CCAACCTCCCCATGGAAACAGTG 0: 1
1: 0
2: 2
3: 25
4: 227
Right 1062919826 10:1271365-1271387 CTGCCTCTCAGAGCAGTGACTGG No data
1062919818_1062919830 30 Left 1062919818 10:1271328-1271350 CCAACCTCCCCATGGAAACAGTG 0: 1
1: 0
2: 2
3: 25
4: 227
Right 1062919830 10:1271381-1271403 TGACTGGAGGAGTCTTTCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062919818 Original CRISPR CACTGTTTCCATGGGGAGGT TGG (reversed) Intronic
900430099 1:2597328-2597350 TCCTGTTGCCATGGGGGGGTAGG - Intronic
900760392 1:4466657-4466679 CACTGTGTCCATGGGGCGCTGGG - Intergenic
900760456 1:4466977-4466999 CACTGTGTCCAGGGGGCAGTGGG - Intergenic
900760465 1:4467010-4467032 CACTGTGTACATGGGGCAGTGGG - Intergenic
902121335 1:14168553-14168575 CACTGTTGCCATGAGGAAGCTGG - Intergenic
902129668 1:14248731-14248753 CACTCTTCCCATGGACAGGTGGG + Intergenic
902218498 1:14949859-14949881 CAGAGTTCCCATGGGGAGATGGG - Intronic
903657055 1:24955975-24955997 GACAGTTTCCCTGGAGAGGTGGG - Intronic
905956078 1:41997249-41997271 CACTCCTTCCATTGAGAGGTTGG - Intronic
907235859 1:53046927-53046949 CACAGTTTCCATGGATAAGTAGG + Intronic
910347411 1:86255764-86255786 CATGGTTTCCATGCAGAGGTAGG + Intergenic
910587276 1:88893403-88893425 CACTGTTTTCTTGAGAAGGTGGG + Intergenic
910958271 1:92731461-92731483 CATTGTGTTCATGGGGAGGAAGG + Intronic
911631285 1:100186208-100186230 GACTGTTTCTAAGGAGAGGTGGG + Intergenic
914717828 1:150266584-150266606 CACTGTTTCCATGGGGCTCTGGG - Exonic
914894274 1:151654433-151654455 CACTGTTACCAAGCAGAGGTCGG - Intronic
915514054 1:156402418-156402440 CACTGTGGCCCTGGGGAGGTGGG - Intergenic
915557724 1:156669657-156669679 CCCTGTTTCCTTGGAGAGGGAGG - Exonic
917155086 1:171988405-171988427 CATTGTTTATATGGAGAGGTTGG + Intronic
919735429 1:200947219-200947241 CACTGTTTCTGTGGAGAAGTTGG + Intergenic
1062898195 10:1121088-1121110 CACAGGTCCCATGGGGAGGCTGG - Intronic
1062919818 10:1271328-1271350 CACTGTTTCCATGGGGAGGTTGG - Intronic
1065831442 10:29618112-29618134 CACTGTTCTCCTGGGGAGGCGGG + Intronic
1065908982 10:30285174-30285196 CACTGTTTCCCTGTTGAGATGGG + Intergenic
1066055114 10:31673684-31673706 CACGTTTTCATTGGGGAGGTGGG + Intergenic
1066259208 10:33712756-33712778 CACTACCTCCATGGAGAGGTGGG + Intergenic
1067349757 10:45465292-45465314 CACTGTTTTCCTGGGGCTGTTGG - Intronic
1068691871 10:59924834-59924856 CAGTGATTCCATGGAGTGGTGGG + Intergenic
1070730712 10:78826293-78826315 CACAGTTGCCATGGTGAGGTGGG + Intergenic
1070774517 10:79101986-79102008 CCCTGGTGCCATGGGGAGGCTGG - Intronic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1073828230 10:107351332-107351354 CATTGTTTCCAAGGAGAAGTTGG - Intergenic
1074967364 10:118503232-118503254 CAATGTTTACATAAGGAGGTGGG - Intergenic
1075058466 10:119237759-119237781 CAGTGTTCCCATGGGGAGTGGGG - Intronic
1075121517 10:119668135-119668157 CACTGTGTCCTTGGGGACATGGG - Intronic
1075588351 10:123673597-123673619 CATTGATTCCATGGGGATTTGGG + Intronic
1076208006 10:128618641-128618663 CTCTGTTTCCATGGTCACGTGGG + Intergenic
1077718326 11:4603041-4603063 CAGTTTCTCCATGGGGATGTAGG - Intronic
1078247494 11:9588614-9588636 CACAGTGTTCAGGGGGAGGTGGG - Exonic
1081011998 11:37825181-37825203 CACTGTTTCTGTGGGAGGGTAGG - Intergenic
1081582889 11:44364774-44364796 CACTGTTACCTTGGGGATGGTGG - Intergenic
1081602261 11:44503611-44503633 CACTGGCTGCATGGGGGGGTGGG + Intergenic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1084352755 11:68615025-68615047 CACTGTTACCTTGGGTAGGATGG - Exonic
1084607932 11:70183439-70183461 CACTATTGCCATGAGGAGGGGGG + Intronic
1085127393 11:74011109-74011131 CACTGTTTTGAAGTGGAGGTGGG + Intergenic
1085761992 11:79249285-79249307 CTCTGTGCCCATGGGTAGGTAGG - Intronic
1086699392 11:89882802-89882824 CATTGTTTCCAGGGTGAAGTTGG - Intergenic
1086706779 11:89961712-89961734 CATTGTTTCCAGGGTGAAGTTGG + Intergenic
1087543048 11:99545356-99545378 CAATTTTTCCAAGGGGATGTGGG + Intronic
1087796973 11:102464405-102464427 CAATTTTTCCATGGAGAGGTGGG - Intronic
1090395590 11:126416097-126416119 CATTGTTTGCTTGGGGGGGTGGG + Intronic
1090424091 11:126595057-126595079 CACTGTTTCCATGCAGCTGTGGG + Intronic
1090522029 11:127489673-127489695 ATCTGCTTCCATGGGGAGGCAGG - Intergenic
1090623224 11:128580488-128580510 CAAAGTTTCCATGGGGAGTAAGG - Intronic
1091009112 11:131982208-131982230 CACTGTTCTCATGGGAAGGGAGG + Intronic
1091990370 12:4950345-4950367 GAGTGTTTCCTTGGGGTGGTGGG + Intergenic
1093735085 12:22612202-22612224 CCTTGTTTTCATGGGGGGGTAGG + Intergenic
1094211529 12:27898245-27898267 CACTGTAACTCTGGGGAGGTGGG - Intergenic
1097746963 12:63313184-63313206 CCCTGCTTCCTTGGGGAGGAAGG + Intergenic
1098010151 12:66042283-66042305 CATTGTTTTCATGGGGAAATGGG + Intergenic
1098858721 12:75683584-75683606 CACTCCTTCCATGAGGAGGTGGG - Intergenic
1098925378 12:76343593-76343615 CACTGTTCCCATTGAGTGGTGGG + Intergenic
1104049900 12:125187774-125187796 CACTGCTTGCATGGGGTGGGGGG - Intronic
1104727653 12:131087777-131087799 CACAGCCTCCATGTGGAGGTGGG + Intronic
1105832051 13:24171355-24171377 TGCTGCTTCCATGGGGAGGGTGG + Intronic
1106819992 13:33454210-33454232 GACTGTTTCCAGTGAGAGGTGGG + Intergenic
1107682111 13:42862785-42862807 CCCTGGTTACATGGGGAGATAGG + Intergenic
1109509380 13:63350330-63350352 CACTGTTTGCCTGGGGTGGAGGG - Intergenic
1111908437 13:94282907-94282929 CACTCTTTTCACGGAGAGGTGGG - Intronic
1112408723 13:99143716-99143738 CATTGCTCTCATGGGGAGGTGGG - Intergenic
1113211749 13:107990914-107990936 CCATGTTTCTATGGGGATGTTGG - Intergenic
1114295217 14:21323032-21323054 CACTGCTTCCATGAGGAACTTGG + Intronic
1115264573 14:31487759-31487781 CAGTGTTCCCAAGTGGAGGTGGG - Intronic
1117827088 14:59715055-59715077 CAGTTTTTCCATGGGAAGGTGGG - Intronic
1118861989 14:69671558-69671580 CACAAATTCCATGGGGAGGCTGG + Intronic
1118957482 14:70496627-70496649 CACTGCTTCCCTGGGCAGGGGGG - Intergenic
1119770250 14:77216200-77216222 CAATGTTTCCAGGAGGAGGGAGG - Intronic
1123036660 14:105474542-105474564 GGCTGTTTCCATGGCGACGTCGG - Intronic
1123683399 15:22780039-22780061 CATTGTTTACCAGGGGAGGTGGG - Intronic
1124335605 15:28854446-28854468 CATTGTTTACCAGGGGAGGTAGG - Intergenic
1124468142 15:29958804-29958826 CACTATTTCTAAGGGAAGGTGGG - Intronic
1125312079 15:38390521-38390543 CACTGTTGCCATGGGATTGTGGG + Intergenic
1126204400 15:46027560-46027582 CACTGTCTCAATGAGGAGATTGG + Intergenic
1127196093 15:56587346-56587368 CAGTGTTTCTATGGGGAGGCAGG + Intergenic
1128609796 15:69064527-69064549 CACACTCTCCATGGTGAGGTGGG - Intergenic
1129757113 15:78105220-78105242 CACTGCTTTCCTGGGGAGCTTGG + Exonic
1133792656 16:9021133-9021155 CAATGTTACCAGGGTGAGGTGGG - Intergenic
1134733669 16:16482452-16482474 CACTTTTTGCAGGGAGAGGTGGG + Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1140143084 16:72278014-72278036 AACTGTATCTAGGGGGAGGTTGG + Intergenic
1141593027 16:85081270-85081292 CACTCTCTCCAAGGGGAGGCGGG - Intronic
1141668700 16:85480264-85480286 CAGTGTTTCGATGGGGATGGAGG + Intergenic
1142441033 16:90097737-90097759 CACTGTGTCCATGGAGGGGCTGG + Intergenic
1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG + Intronic
1144247039 17:13377103-13377125 CACAGTTTCCTTTGTGAGGTTGG - Intergenic
1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1145156936 17:20550171-20550193 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1145799100 17:27672043-27672065 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1147763141 17:42814136-42814158 CATGGATTCAATGGGGAGGTGGG - Intronic
1149189135 17:54037372-54037394 CACAGATTTCATGGGGATGTAGG - Intergenic
1149711473 17:58746181-58746203 CACTTTTCCCATCTGGAGGTGGG + Intergenic
1150546949 17:66168950-66168972 CACAGTTTCCAAGAGGAGGGAGG - Intronic
1151562835 17:74879779-74879801 CACTGTTCAGATGGGGAGGGAGG - Intronic
1151581038 17:74979079-74979101 CACTCTTTCCATGGAGAGGTGGG - Intergenic
1151758361 17:76087411-76087433 CACTGCTTCCAGGGCGAGGACGG + Intronic
1152105205 17:78324661-78324683 CTCTGTCTCCATGGGGATGGAGG + Intergenic
1154140650 18:11821722-11821744 CACTGTTTGCAGAGGCAGGTGGG + Intronic
1155324242 18:24650165-24650187 CACTGGACCCATCGGGAGGTTGG + Intergenic
1158224806 18:55189913-55189935 CCCAGTTTCTGTGGGGAGGTGGG - Intergenic
1158534051 18:58291779-58291801 CACTGTATCCATGGGGTGGGGGG - Intronic
1158911555 18:62068173-62068195 CACTTTCTCCATGGGGATGAAGG + Intronic
1160056984 18:75492440-75492462 CCTGGTTTCCGTGGGGAGGTGGG + Intergenic
1160969700 19:1762145-1762167 CACTGCGTCCAGGGGGAGATGGG - Intronic
1161887910 19:7011346-7011368 CACTGTCTCCATGGAAAGTTGGG - Intergenic
1164397834 19:27881257-27881279 CCCAGTTTCCTTGGGGAGGAAGG - Intergenic
1166034001 19:40154177-40154199 CAATTTTTCCATGGGTAGGGTGG + Intergenic
1167988079 19:53335174-53335196 CCCTCTTCCCATGGTGAGGTAGG + Intronic
1168062240 19:53899276-53899298 GCCTGTTTCCCTGGGGAGCTTGG + Intronic
926697771 2:15782627-15782649 CACTGCTGCCAAGGGGAAGTGGG + Intergenic
926697935 2:15783809-15783831 CACTGTTATAATGAGGAGGTTGG - Intergenic
928032910 2:27796829-27796851 CAATGTTGCCATAGGGAGGCTGG + Intronic
928441895 2:31299213-31299235 GGCAGTTTCCATGTGGAGGTTGG - Intergenic
928730944 2:34231523-34231545 CACTGTTTCCATCAAGAGATGGG + Intergenic
929028705 2:37630152-37630174 CACTTTCACCATGGGGAGGTGGG - Intergenic
932783343 2:74577924-74577946 CAATTTTTCCATGGGGTGGTGGG + Intronic
934994771 2:98947757-98947779 CACTGTTTCCATGGAAAAATAGG + Intergenic
935677629 2:105609532-105609554 CACGGTGTCCATGGCGAGGCAGG - Intergenic
935989213 2:108704435-108704457 CTCCTTTTCCATGGGCAGGTGGG + Intergenic
938090904 2:128434193-128434215 CAGTGTTTCTTTGGGGAGGGAGG + Intergenic
941496721 2:166214312-166214334 AATGGTTTCCATGGGGAAGTTGG - Intronic
942383160 2:175414389-175414411 CACTGTCTCCCTGGTGAGTTGGG - Intergenic
944161194 2:196662369-196662391 CAGTTTTTCCATGGGGTTGTGGG + Intronic
944731376 2:202521044-202521066 CATTGTTGCCATGGGGATGTAGG + Intronic
945048214 2:205800280-205800302 CAGAGCTTCCATGGGGAGGGAGG - Intergenic
945185098 2:207132504-207132526 ATATGTTTCCTTGGGGAGGTGGG + Intronic
945359395 2:208878862-208878884 CACTGATTCCATGGTGGGGTGGG + Intergenic
945884745 2:215363464-215363486 CAGTGATTACATGGGGAGGGAGG - Intronic
1168921326 20:1538490-1538512 CACTCTTCCCATGGAGATGTAGG + Intronic
1168984290 20:2034767-2034789 TTCTGTTTCCCTAGGGAGGTAGG - Intergenic
1172935748 20:38618902-38618924 CAGTCCTCCCATGGGGAGGTGGG - Intronic
1174049950 20:47760550-47760572 CACTGTTTTCAGAGGCAGGTGGG - Intronic
1174203715 20:48824860-48824882 CACGGTTTCCATGGGCCGATGGG + Intronic
1174551986 20:51368790-51368812 CAGTGTTGCCATGGGGCGGGTGG + Intergenic
1175459387 20:59140410-59140432 TACTGTTCCCATGGGGTGGAGGG - Intergenic
1175607172 20:60320699-60320721 CACTATTTCCATGGGCAGCAGGG + Intergenic
1177456099 21:21342095-21342117 CATTTATTCCATGGGGAGGAAGG - Intronic
1178346952 21:31837649-31837671 CACTCTGTACATGGTGAGGTTGG + Intergenic
1178457214 21:32766587-32766609 CACTGCTTCCTTGGGAAGTTTGG - Intronic
1178735389 21:35144578-35144600 CAATGTTTCCATTGGGTGTTGGG + Intronic
1179886554 21:44316618-44316640 CACTGTGTCCATGTGGCTGTGGG + Intronic
1183683468 22:39348966-39348988 CACTGGTTCCAGGAGCAGGTTGG - Intergenic
1185396710 22:50595454-50595476 CACTCTTCCCATGGAGGGGTAGG + Intronic
950151707 3:10692662-10692684 CAGTGTTGCCCTGGGGAGGCCGG - Intronic
950663185 3:14479620-14479642 GGGTGTTTCCATGGAGAGGTGGG + Intronic
950923489 3:16717521-16717543 CACTGCTTCCCTGGGGAGGCGGG + Intergenic
955305409 3:57825975-57825997 CAGTGTTTCTATGGGGAGCTTGG + Intronic
955737492 3:62054926-62054948 CCATGTTTCCATGGGGAAATGGG + Intronic
957695333 3:83630101-83630123 TACTATTTCCATAGAGAGGTTGG + Intergenic
959141235 3:102488987-102489009 CACTGTTCTCATGGGGAGATGGG - Intergenic
959801843 3:110504448-110504470 CACTGATTCCATGGGCAGTCAGG + Intergenic
961044227 3:123697899-123697921 GACGGTTTCCATGGGAAGGGAGG + Intronic
961437747 3:126931200-126931222 AACTCTTTCCATGGGAAGGTAGG - Intronic
961865658 3:129951847-129951869 CACTGTAAGCATGGGGAAGTAGG - Intergenic
962388039 3:134948782-134948804 CACTGACTCCTTGGGGAGGTAGG + Intronic
962970020 3:140391357-140391379 CACTATTTGCGTGGGGGGGTGGG + Intronic
968931842 4:3584598-3584620 CCCTCTTCCCTTGGGGAGGTCGG - Intronic
969320326 4:6408518-6408540 TAAGGTTTCAATGGGGAGGTAGG + Intronic
969563978 4:7966869-7966891 CTCTGTGTCCATGGGGTGGGCGG - Exonic
971573505 4:28244954-28244976 CACAGTATCCATGGGGAAATTGG - Intergenic
972151856 4:36101237-36101259 TTCAGTATCCATGGGGAGGTGGG - Intronic
972916171 4:43882805-43882827 CACTTTTTCCATGGGGTGGTGGG - Intergenic
974988849 4:69060896-69060918 CACTGATTCAATGGGGAGCAAGG - Intronic
977063428 4:92284233-92284255 CACTATTTTCATGGAGAAGTAGG - Intergenic
979307299 4:119162075-119162097 AACTCTTTCCTCGGGGAGGTAGG + Intronic
980861277 4:138502104-138502126 ACCTGTCTCCATGGGAAGGTAGG + Intergenic
985422771 4:189801260-189801282 CATTTTTTCCATCGGGAGGTGGG + Intergenic
985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG + Intergenic
986394018 5:7310563-7310585 CATTGTTTACCAGGGGAGGTAGG - Intergenic
987769798 5:22286972-22286994 CACTGTTTCCATAACCAGGTGGG + Intronic
991917983 5:71624159-71624181 CACTAATCCCATGGGGAGGGGGG + Intronic
992857533 5:80877983-80878005 CACAAATGCCATGGGGAGGTAGG + Intergenic
993059386 5:83020894-83020916 CTTAGTTTCCATGGGCAGGTTGG + Intergenic
994718565 5:103353220-103353242 CACTCTTCCCATTGAGAGGTGGG + Intergenic
995604299 5:113834703-113834725 CTCTGATTCCGTGGGGAGGAGGG + Intergenic
997390661 5:133512180-133512202 CACTCTTTCCCTGGGGCTGTAGG + Intronic
999078089 5:148816409-148816431 CAGTGTTTACATGGGGAGATAGG + Intergenic
1000958402 5:167570174-167570196 CAGTGTTTACATGGATAGGTTGG + Intronic
1002081187 5:176738446-176738468 CACCCTCACCATGGGGAGGTGGG - Intergenic
1002569947 5:180134581-180134603 CACTGTATAAAAGGGGAGGTGGG - Intronic
1003965309 6:11247065-11247087 CAGTGTTTTCAAGGGGAGATGGG - Intronic
1004019423 6:11763283-11763305 CACTGTGTCCAAGGGGAGAGTGG + Intronic
1005308293 6:24534538-24534560 CACTGTATCCATGGGATGGGAGG - Intronic
1007778437 6:44237326-44237348 AACTGTTTCCTGGGGCAGGTTGG + Intergenic
1008083583 6:47220491-47220513 TACTGTTTCCAAGGGGAAATGGG + Intergenic
1008334159 6:50280141-50280163 CACACTTTCCAAGTGGAGGTAGG - Intergenic
1008747440 6:54689853-54689875 CCCAGTTTCTATAGGGAGGTAGG + Intergenic
1009326065 6:62348808-62348830 GTCTGTTTCCCTGGGGAGTTTGG + Intergenic
1009513443 6:64582406-64582428 CAGTTTTTCCATGGGGGGCTAGG - Intronic
1010605287 6:77882203-77882225 CTCTGATTCCATGGGAAGATGGG - Intronic
1011412388 6:87079359-87079381 CGCTGTTTACATGGGCAGGGTGG - Intergenic
1012934798 6:105355442-105355464 CACTGTTTCCACTGGGAATTTGG + Intronic
1013008299 6:106095854-106095876 CCCTGTGTCCATGGGGATGCTGG - Intronic
1014828267 6:126071209-126071231 CCCTGTTTCCTTGGGGGGGTGGG + Intergenic
1016907786 6:149168922-149168944 CACAGTTCCCAAGGGGAGGAGGG + Intergenic
1018035595 6:159878615-159878637 CTCTGCTTCCCGGGGGAGGTGGG - Intergenic
1018339094 6:162830522-162830544 CACTGTGTCCCTGGGGAGAGGGG - Intronic
1018907773 6:168085344-168085366 CACTGTGGCCATGTGGAGGGAGG - Intergenic
1023633809 7:42188803-42188825 CACTGTTTGCTAGGGGTGGTAGG + Intronic
1025057737 7:55778689-55778711 CATTGCTCCCATGGTGAGGTCGG + Intergenic
1025220238 7:57101858-57101880 CATTGCTCCCATGGTGAGGTCGG + Intergenic
1025631017 7:63273440-63273462 CATTGCTCCCATGGTGAGGTCGG + Intergenic
1026514489 7:71056671-71056693 CACAATGTCCATGGGAAGGTTGG + Intergenic
1029612194 7:101632610-101632632 CACTTTTTCCATGGAGAGGCGGG + Intergenic
1030359596 7:108580615-108580637 CACTGTCTCCATGGCCAAGTGGG + Intergenic
1034480897 7:151319915-151319937 CACTGCTTCAACAGGGAGGTGGG + Intergenic
1036597801 8:10229896-10229918 CACTGATTATATGGGGAGGACGG - Intronic
1037145192 8:15563340-15563362 TACTGTTTGCATGGTGATGTTGG + Intronic
1040276741 8:46017738-46017760 CACTGGGTCCATGGGGATTTTGG - Intergenic
1040775859 8:51042583-51042605 CACTGGTACCATGGGGAGTGTGG + Intergenic
1041349379 8:56933479-56933501 CACTGTTTCAGTCGGGAGGCAGG - Intergenic
1044892116 8:96848028-96848050 CACTGATGACATGGGGAGGTTGG - Intronic
1046745921 8:117875827-117875849 CACTGCTTGCATGGGGAGAAGGG - Intronic
1047774903 8:128061989-128062011 CCCTGTGTCCATGGGAAGGTGGG - Intergenic
1049414443 8:142488871-142488893 CACTGTGTCCGTGGGTGGGTGGG + Intronic
1050095653 9:2062919-2062941 AACTGTTTCCAGTTGGAGGTGGG + Intronic
1051153045 9:14106192-14106214 GTCTGTTTTCATGTGGAGGTGGG + Intronic
1053280594 9:36817834-36817856 CTCTGTTTCCAAGCAGAGGTAGG - Intergenic
1053530831 9:38879311-38879333 CAATGTTGCAGTGGGGAGGTGGG - Intergenic
1054203055 9:62103744-62103766 CAATGTTGCAGTGGGGAGGTGGG - Intergenic
1054458287 9:65447331-65447353 CCCTCTTCCCTTGGGGAGGTCGG + Intergenic
1054635308 9:67484621-67484643 CAATGTTGCAGTGGGGAGGTGGG + Intergenic
1054841708 9:69748948-69748970 AACTGCTTCCATGGGGATGTAGG + Intronic
1055648093 9:78379606-78379628 CCCTGTTTCTGTGGGAAGGTAGG - Intergenic
1058030642 9:100193603-100193625 CACTGGTTGCTTGGGGAGGGAGG - Intronic
1058421386 9:104836325-104836347 TCCTGTTTCCATGGTGAGGGAGG - Intronic
1059334379 9:113559536-113559558 CACCGTTTCCATTAGCAGGTTGG + Intronic
1059999852 9:119948405-119948427 CACTGGTTCCAGGAGGAGGATGG - Intergenic
1185593133 X:1291711-1291733 CACTGGGTCCAAGTGGAGGTGGG - Intronic
1185593499 X:1293789-1293811 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1185593520 X:1293875-1293897 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1185593549 X:1294005-1294027 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1187213681 X:17254141-17254163 CACTGTTCCCAGGGGGATGAAGG - Intergenic
1189381881 X:40507849-40507871 CACTGTTTCCATGTGTACTTGGG - Intergenic
1190418219 X:50201919-50201941 CCCTGTCTCTATGGGAAGGTAGG - Intergenic
1192261250 X:69506852-69506874 CACTGTCACCATGGGGTGCTGGG - Intronic
1193643923 X:84044218-84044240 GTCTGTTTCCAGGTGGAGGTTGG + Intergenic
1196138924 X:112239367-112239389 CCCTGCTTCCATGGGGTGGATGG - Intergenic
1196581689 X:117386797-117386819 CACTTTTCCCATGGAGAAGTGGG - Intergenic
1198319889 X:135510316-135510338 CACTCTTCCCACTGGGAGGTGGG - Intergenic
1200209951 X:154342698-154342720 GACTGTCTCCTGGGGGAGGTAGG + Intergenic
1200220901 X:154389394-154389416 GACTGTCTCCTGGGGGAGGTAGG - Intergenic
1200768926 Y:7105786-7105808 CACTGCTAACATGAGGAGGTGGG + Intergenic