ID: 1062925708

View in Genome Browser
Species Human (GRCh38)
Location 10:1314232-1314254
Sequence GAGAAACCTCAGCTCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062925708_1062925716 19 Left 1062925708 10:1314232-1314254 CCCCAGCAGAGCTGAGGTTTCTC No data
Right 1062925716 10:1314274-1314296 GTAAGGACATCTCCCCTCGCAGG No data
1062925708_1062925711 2 Left 1062925708 10:1314232-1314254 CCCCAGCAGAGCTGAGGTTTCTC No data
Right 1062925711 10:1314257-1314279 CAGCCGCCTCCCTTTCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062925708 Original CRISPR GAGAAACCTCAGCTCTGCTG GGG (reversed) Intronic