ID: 1062926778

View in Genome Browser
Species Human (GRCh38)
Location 10:1322020-1322042
Sequence CAGAGGAGGGAGGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3287
Summary {0: 1, 1: 2, 2: 47, 3: 465, 4: 2772}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062926778_1062926793 19 Left 1062926778 10:1322020-1322042 CCTGCCTCCTCCTCCCTCCTCTG 0: 1
1: 2
2: 47
3: 465
4: 2772
Right 1062926793 10:1322062-1322084 AGGAGACACCAGTTGGTACCTGG No data
1062926778_1062926792 12 Left 1062926778 10:1322020-1322042 CCTGCCTCCTCCTCCCTCCTCTG 0: 1
1: 2
2: 47
3: 465
4: 2772
Right 1062926792 10:1322055-1322077 TGGACTCAGGAGACACCAGTTGG No data
1062926778_1062926784 -8 Left 1062926778 10:1322020-1322042 CCTGCCTCCTCCTCCCTCCTCTG 0: 1
1: 2
2: 47
3: 465
4: 2772
Right 1062926784 10:1322035-1322057 CTCCTCTGACCACCCAGCCCTGG No data
1062926778_1062926786 -1 Left 1062926778 10:1322020-1322042 CCTGCCTCCTCCTCCCTCCTCTG 0: 1
1: 2
2: 47
3: 465
4: 2772
Right 1062926786 10:1322042-1322064 GACCACCCAGCCCTGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062926778 Original CRISPR CAGAGGAGGGAGGAGGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr