ID: 1062929149

View in Genome Browser
Species Human (GRCh38)
Location 10:1340987-1341009
Sequence CAGGGTTCTCTGGTGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 1, 2: 21, 3: 34, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062929149_1062929152 -10 Left 1062929149 10:1340987-1341009 CCAGCATCCACCAGAGAACCCTG 0: 1
1: 1
2: 21
3: 34
4: 207
Right 1062929152 10:1341000-1341022 GAGAACCCTGTGCCCCACATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062929149 Original CRISPR CAGGGTTCTCTGGTGGATGC TGG (reversed) Intronic
900553104 1:3266346-3266368 CATTGTTCTCTGGTGGATTACGG - Intronic
900783650 1:4633957-4633979 CAGACTCCTCTGGGGGATGCTGG + Intergenic
901643079 1:10702841-10702863 CAGGGCTCTCTGCACGATGCCGG + Intronic
901703248 1:11056562-11056584 CAGGGTTTTCTGGCAGCTGCAGG - Intronic
903510898 1:23874232-23874254 CTGTGGTCTCTGGAGGATGCAGG + Exonic
903753220 1:25643003-25643025 CAGGGTTCTGTGGGGGACGTAGG + Intronic
903827515 1:26156543-26156565 CAGGGATCTCTGGTGGGGGCTGG - Intergenic
904031701 1:27537140-27537162 CAGGGTTCTCTCATGGAGGTGGG + Intronic
904374051 1:30068645-30068667 GAGGGTTCTGGGGTGAATGCAGG + Intergenic
907047554 1:51308966-51308988 CAGGGTGTTCTGGTGGGGGCAGG - Intronic
912425844 1:109588970-109588992 CAGGTTTCTGTCTTGGATGCTGG + Intronic
912551141 1:110486072-110486094 CAGGGGTCTCATGTGGAAGCAGG + Intergenic
913245737 1:116868554-116868576 CTGGCTTCCCTGGGGGATGCAGG - Intergenic
913328214 1:117646276-117646298 CAGGTTTCTCTGGAGGATGCTGG + Intergenic
913666612 1:121054630-121054652 CTAGGTTCTCTGGTGGATGTGGG - Intergenic
914018295 1:143841754-143841776 CTAGGTTCTCTGGTGGATGTGGG - Intergenic
914656910 1:149750271-149750293 CTAGGTTCTCTGGTGGATGTGGG - Intergenic
915081510 1:153355737-153355759 CAGGGTTGGCTGCTGGCTGCTGG + Intergenic
915892592 1:159785246-159785268 CAGAGTTCTCTGGTGAACGGAGG + Intergenic
920746646 1:208635349-208635371 CATGCTTCTCTGCTGGCTGCTGG - Intergenic
922011065 1:221588047-221588069 CAGGGTCCTGTGCTGCATGCAGG + Intergenic
1062928974 10:1340105-1340127 CGTGGTTCTCTGGTGGATGCCGG - Intronic
1062928982 10:1340147-1340169 TGTGGTTCTCTGGTGGATGCTGG - Intronic
1062928991 10:1340189-1340211 CGTGGTTCTCTGGTGGATGCCGG - Intronic
1062928999 10:1340231-1340253 TGTGGTTCTCTGGTGGATGCTGG - Intronic
1062929008 10:1340273-1340295 TGTGGTTCTCTGGTGGATGCCGG - Intronic
1062929017 10:1340315-1340337 CGTGGTTCTCTGGTGGATGCCGG - Intronic
1062929026 10:1340357-1340379 TGTGGTTCTCTGGTGGATGCCGG - Intronic
1062929035 10:1340399-1340421 CGTGGTTCTCTGGTGGATGCCGG - Intronic
1062929044 10:1340441-1340463 TGTGGTTCTCTGGTGGATGCCGG - Intronic
1062929053 10:1340483-1340505 CGTGGTTCTCTGGTGGATGCCGG - Intronic
1062929062 10:1340525-1340547 TGTGGTTCTCTGGTGGATGCCGG - Intronic
1062929071 10:1340567-1340589 CGTGGTTCTCTGGTGGATGCCGG - Intronic
1062929080 10:1340609-1340631 TGTGGTTCTCTGGTGGATGCCGG - Intronic
1062929089 10:1340651-1340673 CGTGGTTCTCTGGTGGATGCCGG - Intronic
1062929098 10:1340693-1340715 CGTGGTTCTCTGGTGGATGCCGG - Intronic
1062929106 10:1340735-1340757 CGTGGTTCTCTGGTGGATGCTGG - Intronic
1062929114 10:1340777-1340799 CGTGGTTCTCTGGTGGATGCTGG - Intronic
1062929122 10:1340819-1340841 TGTGGTTCTCTGGTGGATGCTGG - Intronic
1062929130 10:1340861-1340883 CGTGGTTCTCTGGTGGATGCTGG - Intronic
1062929138 10:1340903-1340925 CTTTGTTCTCTGGTGGATGCTGG - Intronic
1062929149 10:1340987-1341009 CAGGGTTCTCTGGTGGATGCTGG - Intronic
1062929158 10:1341029-1341051 CGTGGTTCTCTGGTGGATGCTGG - Intronic
1062929176 10:1341155-1341177 CATGGTTCTCTGGTGGATGCTGG - Intronic
1062929184 10:1341197-1341219 CGTGGTTCTCTGGTGGATGCTGG - Intronic
1062929192 10:1341239-1341261 TGTGGTTCTCTGGTGGATGCTGG - Intronic
1062929200 10:1341281-1341303 CGTGGTTCTCTGGTGGATGCTGG - Intronic
1062929208 10:1341323-1341345 CGTTGTTCTCTGGTGGATGCTGG - Intronic
1062929220 10:1341407-1341429 CGTCGTTCTCTGGTGGATGCTGG - Intronic
1062929228 10:1341449-1341471 CGTGGTTCTCTGGTGGATGCCGG - Intronic
1062929236 10:1341491-1341513 TGTGGTTCTCTGGTGGATGCTGG - Intronic
1062929251 10:1341575-1341597 CGTGGTTCTCTGGTGGATGCTGG - Intronic
1062929259 10:1341617-1341639 CGTTGTTCTCTGGTGGATGCTGG - Intronic
1062929274 10:1341701-1341723 CGTGGTTCCCTGGTGGATGCTGG - Intronic
1062929282 10:1341743-1341765 CTTTGTTCTCTGGTGGATGCTGG - Intronic
1062929293 10:1341827-1341849 GTTGGTTCTCTGGTGGATGCTGG - Intronic
1062929300 10:1341869-1341891 CTTTGTTCTCTGGTGGATGCTGG - Intronic
1064927001 10:20580459-20580481 CATGGTTCTCTGGAGGATTCAGG + Intergenic
1067693262 10:48518026-48518048 CAAATTTCTCTGCTGGATGCTGG + Intronic
1071416279 10:85444804-85444826 CTGTGATCTCTGGAGGATGCAGG - Intergenic
1074225934 10:111484320-111484342 CAAAGTGCTTTGGTGGATGCAGG + Intergenic
1074436101 10:113435776-113435798 AAGGATTCTCTGGTGGATGTGGG + Intergenic
1075273340 10:121072090-121072112 TAGGGTTTTCTGGTGGATTGTGG + Intergenic
1075619986 10:123919420-123919442 CTGGGTTATCTTGTGGTTGCTGG - Intronic
1075733128 10:124648121-124648143 GAGGGTTTTCTGGAGGAGGCAGG - Intronic
1076360301 10:129883729-129883751 CACCGTTCACTGGTGGTTGCTGG + Intronic
1076613908 10:131743797-131743819 CAGGGCTGTCTGGGAGATGCTGG - Intergenic
1078748581 11:14138775-14138797 TCTGGTTCTCTGCTGGATGCTGG + Intronic
1079402652 11:20118306-20118328 CAGGGTGATGTGGGGGATGCAGG - Exonic
1082076049 11:47977082-47977104 CAGGGAGCTATGGTGGATGGAGG + Intergenic
1083313343 11:61797923-61797945 CAGGTTCCTCTGGTTGAAGCTGG + Intronic
1084378994 11:68798665-68798687 CCGAGCTCGCTGGTGGATGCAGG - Intronic
1084389194 11:68864091-68864113 CAGGCTTCTCTGGTGGAGGCAGG + Intergenic
1084452946 11:69250893-69250915 CATGCTTCTCTGTGGGATGCTGG + Intergenic
1084510669 11:69601646-69601668 CAGGGCTCTGAAGTGGATGCTGG - Intergenic
1084742035 11:71146267-71146289 CAGCTTGCTCTGGTGGATTCAGG + Intronic
1087714550 11:101593692-101593714 CAGTGTTGTCTGGTGGGTACTGG + Intronic
1089325851 11:117656300-117656322 CAGGGTTACCTGGTGGAGCCAGG - Intronic
1091415217 12:276895-276917 CTGGGTTCTCAGGGAGATGCTGG - Intergenic
1091891377 12:4057330-4057352 CAAGGCTCCCTGGTGGATGAGGG + Intergenic
1097066382 12:56323690-56323712 CAGGGATCTCTGGTGGAGTGAGG - Intronic
1098850378 12:75589053-75589075 CAGAGTTCTCTGGGTGATGGGGG - Intergenic
1100610440 12:96187515-96187537 CACGGTTCTGTGGGGGATGTAGG + Intergenic
1101402881 12:104403674-104403696 CTGGGTTCTGGGTTGGATGCTGG - Intergenic
1101701672 12:107179649-107179671 CAGGGTCCTCTGTGGGATGCTGG - Intergenic
1102152278 12:110697084-110697106 CAGGCTTCTCTGCTTGATGGAGG - Intronic
1102519925 12:113471761-113471783 CAGGTATCTCGGGTGGCTGCTGG + Exonic
1103400167 12:120638652-120638674 CAGGGTCCTCTGGGATATGCAGG - Intergenic
1103735815 12:123060246-123060268 CAGGGTGCTTTGGTGAATGAAGG - Intronic
1104904521 12:132206111-132206133 CAGGATTCTGTGGTGGGTGGGGG - Intronic
1105899299 13:24742175-24742197 CAGGGTTCTTTGGAGGAAGAAGG + Intergenic
1108740707 13:53335276-53335298 CAGTGTTGTGTGGTCGATGCTGG - Intergenic
1113561680 13:111286578-111286600 CAGGGTGCTTTGGGAGATGCTGG - Intronic
1113787232 13:113008890-113008912 CTGGGTTCTCTGATGCAGGCGGG - Intronic
1116049724 14:39788178-39788200 CTGTGTTCCCTGGTGGACGCAGG + Intergenic
1118845438 14:69544549-69544571 CAAGGTTCTCTGGTGGAAGCAGG - Intergenic
1120846943 14:89134432-89134454 TAGGGTTTTCTTGTGGAGGCTGG + Intronic
1122203964 14:100139076-100139098 CAGGGTGCCATGGTGGAGGCTGG + Intronic
1122599033 14:102912236-102912258 CAGGGCGCTGTGGTGGCTGCAGG - Intergenic
1125600041 15:40910516-40910538 CAGGGTGCAGTGGGGGATGCTGG - Intergenic
1125798801 15:42425948-42425970 CAGGGTTGGCTGGGGGATGAAGG - Intronic
1127393266 15:58523513-58523535 CAGAGTTCTCTGGGGCATGAAGG + Intronic
1128458510 15:67847842-67847864 CAGGGTTCTCAGGACCATGCTGG + Intergenic
1128614723 15:69100226-69100248 CTGGGTTCTCGGGCAGATGCAGG - Intergenic
1130076410 15:80694746-80694768 CAGGTTTCTCCCGTGGATGGAGG - Intronic
1131051011 15:89347876-89347898 CAGGGTCCTCAGGTGCATTCTGG - Intergenic
1131464601 15:92645369-92645391 CAGGGTTGTCTGGCCCATGCTGG - Intronic
1132146287 15:99431876-99431898 CAAGGTTCTCTGTGGGGTGCAGG - Intergenic
1133087278 16:3374804-3374826 CTGGGGCCTCTGGTGGCTGCTGG - Intronic
1133127266 16:3655158-3655180 GCGGGTTTTCTGGTGGATGGAGG + Intronic
1133775130 16:8889693-8889715 CAGAGTTCGCTGGTGGCTGGTGG + Intergenic
1133796103 16:9047768-9047790 CAGGGCTCTCTGGGGAGTGCTGG + Intergenic
1134309349 16:13061609-13061631 CAGGGTACTGTGCTGGGTGCTGG + Intronic
1137271597 16:46906001-46906023 CAGGGTTCTGTGGTTGATGCTGG + Intronic
1138353646 16:56360722-56360744 CCGGGTGCTCTGGTGAATGGTGG - Intergenic
1139532273 16:67548199-67548221 CAGGGGTCCCTGGAGGAGGCCGG + Intergenic
1140049086 16:71463572-71463594 CTGTCTTCTCTGGTGGCTGCAGG + Exonic
1141119784 16:81344290-81344312 CAGGGTTCTCTTGGCTATGCGGG - Intronic
1141481189 16:84308091-84308113 AAGGGTTCTCTGGGTGAAGCAGG + Intronic
1141657530 16:85424011-85424033 CTGGCCTCCCTGGTGGATGCAGG - Intergenic
1143709895 17:8726948-8726970 CAGGCGTCTCTAGTGGATGGAGG - Intergenic
1144102247 17:11952041-11952063 CAGGAAGCTCTGGTGGATGATGG + Intronic
1147169502 17:38609736-38609758 TAAGGTTCTCTGGAGGAGGCTGG - Intergenic
1147663376 17:42129537-42129559 CTGGGTTCTCTGCTGGGTCCAGG - Intronic
1147667125 17:42155807-42155829 AAGAGTTCTCTGCAGGATGCTGG + Intergenic
1148180266 17:45600419-45600441 CAGGGTTCTTCGGTGGGTGTTGG + Intergenic
1148341931 17:46878418-46878440 CAGGGCAGTCTGCTGGATGCTGG + Intronic
1148667271 17:49383964-49383986 CAGGGTTCCAAGGTGGATGAGGG - Intronic
1152168295 17:78725120-78725142 CTGAGTACTCTGGTGGATCCCGG - Intronic
1153439080 18:5097421-5097443 CAGACTTCTCTGGTAGATGGAGG - Intergenic
1156454938 18:37287567-37287589 CAGGGCTGGCTGGTGGATGGAGG - Intronic
1156487046 18:37472978-37473000 CAGGGTTCGGGGGTTGATGCAGG - Intronic
1158216806 18:55109184-55109206 CAAGGCACTCTGCTGGATGCTGG - Intergenic
1158548865 18:58417908-58417930 CAGGGCTCTCTGTAGAATGCAGG + Intergenic
1158568226 18:58574122-58574144 TTGGGTTCTCTTGTGAATGCTGG - Intronic
1159981953 18:74792830-74792852 CAGGCTGCTCTGGTTGAAGCTGG + Intronic
1160803821 19:982765-982787 CACGGTTCTCTGGGGGTCGCTGG + Intergenic
1162430439 19:10625364-10625386 CAGGGTTCCCGGGTGGGGGCGGG + Exonic
1163250309 19:16122851-16122873 CACAGTTCTCTGGTGGAGGGTGG + Intronic
1163603938 19:18264185-18264207 CAGGGGACCCTGGTGAATGCTGG + Intronic
1163696907 19:18768739-18768761 CAGGGTTCTCTGGGGGGGACTGG - Exonic
1164687666 19:30178822-30178844 CAGGGGTCTTTGGGGGAAGCAGG + Intergenic
1165506800 19:36237501-36237523 CAGGTTTCTCTGTTGGACACAGG - Exonic
1167669774 19:50844079-50844101 CAGGTTTCTCAGGTGGAGGATGG + Intergenic
1168246395 19:55114855-55114877 CTGGGGCCTCTGGGGGATGCAGG + Intronic
925057489 2:866472-866494 CAGGGGACTGTGGAGGATGCAGG - Intergenic
925238110 2:2296978-2297000 CAGGTTTCTCTGCAGGAAGCTGG + Intronic
926537327 2:14129233-14129255 CTGGGTTCTGTGGTGGATGTTGG + Intergenic
929856747 2:45643821-45643843 CAGCGCCCTCTGGTGGACGCTGG - Intergenic
934916482 2:98304711-98304733 CAGGGATCACTGATGGATCCAGG - Intronic
935706273 2:105860352-105860374 TAGGGTCCCCTTGTGGATGCAGG - Intronic
935731930 2:106071452-106071474 CAGGGGTTTCTGGTGGATAGGGG + Intronic
936088203 2:109483993-109484015 TGGGGTTGTCTGGTGGACGCTGG - Intronic
936243134 2:110805508-110805530 CAGGGTTCCCGGTTAGATGCTGG + Intronic
938614851 2:132987116-132987138 CAGGGTGGTCTAGTGGCTGCAGG - Intronic
938771213 2:134502811-134502833 CAGGGTTCCCGGGTGGAGTCGGG - Intronic
942115667 2:172726675-172726697 CAGGGGCCTTTGGTGGCTGCAGG + Intergenic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
945923114 2:215776482-215776504 CAGGGTTCCATGATGGATGGGGG + Intergenic
947909353 2:233791203-233791225 CAGGGTCGCCTGGTGAATGCAGG + Intronic
949037342 2:241821902-241821924 CAGGGCTCTGTCGTGGAGGCAGG + Intergenic
1173020579 20:39264667-39264689 CAGGCTTTTCTGTGGGATGCAGG - Intergenic
1173601255 20:44296965-44296987 CAGGGTTCACTAGGGGATGAGGG - Intergenic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1174554734 20:51386035-51386057 CAGGGTGCTCTTCTGGAAGCTGG + Intergenic
1174656159 20:52174095-52174117 CCTGGTTCTGTGGTGGGTGCAGG - Intronic
1178949417 21:36974133-36974155 CAGGGTCCCCTGGTGGAAGCTGG + Intronic
1179799122 21:43802712-43802734 CAGGAATCTCTGGAGGGTGCGGG - Intronic
1180606247 22:17061197-17061219 CTGGGATCTCTGGCTGATGCTGG - Intergenic
1180983203 22:19889075-19889097 TAGGGGTCCCTGGTGGCTGCTGG - Intronic
1181342687 22:22195497-22195519 CAGCGCCCTCTGGTGGATGTGGG - Intergenic
1182085371 22:27557498-27557520 CAAGGGTCTCTGCTGGGTGCTGG - Intergenic
1182552357 22:31107193-31107215 CAGGCTTCCACGGTGGATGCTGG + Intronic
1185032589 22:48452335-48452357 CATGGTGCTCGGGTGGGTGCTGG - Intergenic
949844797 3:8358354-8358376 CAGGGTTCTCTCTTGACTGCTGG - Intergenic
950567652 3:13780654-13780676 GAGCATTCTCTGGTGGGTGCTGG + Intergenic
950741161 3:15052714-15052736 CAGGTGTCCCTGGTGGATGGTGG - Intronic
953097790 3:39795726-39795748 CAGATTTCTCTGGAGGTTGCTGG + Intergenic
954148327 3:48645316-48645338 CAGGGTTTTCAGCAGGATGCTGG - Intronic
954636613 3:52074350-52074372 CAGGGTGCTCTGGCAGCTGCTGG - Intergenic
957714636 3:83909989-83910011 CAGGTTCCTCTGGTGCCTGCTGG + Intergenic
957946296 3:87067630-87067652 CAGGGCTCTGTGGTGGACCCTGG + Intergenic
959959182 3:112276800-112276822 CAGGGTTGGATGGTGGATGTTGG + Intronic
960963690 3:123090137-123090159 CAGGGATGCCTGGAGGATGCAGG - Intronic
961166967 3:124770147-124770169 CAGGCTCCTCTGGTGGCTGGGGG + Intronic
961202824 3:125057782-125057804 CAGGCTTCTCGTGTGGATTCAGG + Intergenic
961414280 3:126746010-126746032 GAGGCTTCTCTGGAGGATTCTGG + Intronic
962111196 3:132450734-132450756 CAGAGTACTCTGTTGGTTGCAGG - Exonic
964942655 3:162178281-162178303 CAGAGTTCTATGGTTGAAGCTGG - Intergenic
968555877 4:1246247-1246269 CAGGGTCCTCTGGTGGTCGCTGG - Intronic
968666097 4:1823162-1823184 CAGGGGCCTCTGGTGGCTTCTGG - Intronic
969483447 4:7458931-7458953 AAGGCTTCTCTGCTGGCTGCGGG + Intronic
970739339 4:19215648-19215670 CCAGGTTCTGTGTTGGATGCTGG + Intergenic
976124108 4:81815159-81815181 TAGGGCTCTCTGCTGGATACAGG - Intronic
976674805 4:87692289-87692311 CAGGGTCCTATGCTGGGTGCAGG + Intergenic
976731633 4:88267682-88267704 CAGATTTCTCTGGTGCCTGCTGG - Intronic
979379078 4:119987120-119987142 TTGGGTTCTCTGTTGGTTGCAGG - Intergenic
979762954 4:124429430-124429452 CTTGGCTCCCTGGTGGATGCAGG - Intergenic
982293461 4:153803284-153803306 CAGGGTTGCTTGGTGAATGCAGG - Intergenic
982294230 4:153810091-153810113 CAGGGAAGTCGGGTGGATGCAGG - Intergenic
982476863 4:155863590-155863612 CAGGGTGCTCTGGTTGGTGGTGG - Exonic
982592148 4:157326919-157326941 CAGGGAGCGCTGGTGGAGGCAGG + Intronic
983077048 4:163338669-163338691 TTGGGATCTCTGGTGGATTCTGG - Intronic
985012833 4:185601518-185601540 CTGGGTTCTCTGATGACTGCGGG + Intronic
988503100 5:31799576-31799598 CAGGGTCCTGTGCTGGATGTGGG + Exonic
988923357 5:35964336-35964358 CTGGGTTCTCTGGGTGACGCTGG - Intronic
990314088 5:54567796-54567818 CAGGGTGCTCTGGGCAATGCTGG - Intergenic
992198009 5:74358508-74358530 ATGGGTTCTCTGGTAGATTCAGG - Intergenic
992308109 5:75464434-75464456 CAGGGTGCTATGGGGGATGCGGG + Intronic
992467213 5:77018407-77018429 CAGAGTTCCCTGGTGCAGGCAGG + Intergenic
993000689 5:82377857-82377879 CAGGGTTCTCGGGTCAATCCAGG + Intronic
995721599 5:115140498-115140520 CTGGATTTTCTGTTGGATGCTGG - Intronic
997730872 5:136174176-136174198 GAGGCTTCTCTTGTAGATGCAGG + Intronic
1000339431 5:160266031-160266053 CAGGGTAGGCTGGTGGCTGCTGG - Intronic
1001591641 5:172869455-172869477 CATGGCTCTCTGGTGGGTCCAGG + Intronic
1004587986 6:17021095-17021117 CAGGGTACTGTGGTAGGTGCTGG + Intergenic
1005498951 6:26413254-26413276 CAGGGTTGTCTGGCAGATCCTGG - Exonic
1006978196 6:38123491-38123513 CAGGGTTTTCTGGTGGATCTAGG - Intronic
1007274692 6:40664685-40664707 CATGGTTGACTGGTAGATGCTGG - Intergenic
1007303988 6:40890413-40890435 CAGAGGTCTGGGGTGGATGCAGG - Intergenic
1010554426 6:77261618-77261640 TAGGTTTCTATGTTGGATGCTGG - Intergenic
1014825221 6:126042388-126042410 CAGGGCTCTTTGGGGGATGGAGG + Intergenic
1015735736 6:136398166-136398188 CAGGGTACTGTGGTGGATAGAGG + Intronic
1016303144 6:142654254-142654276 CGGGGTTCTCTGGTGGATCTTGG - Intergenic
1016815553 6:148299693-148299715 CAGGGTTCTCTGGGGTTTGATGG + Intronic
1017776551 6:157685370-157685392 CAGGGTTCTCTTTTGTAAGCTGG - Intergenic
1018994341 6:168699873-168699895 CAGGGTTCTCTAGCAGACGCTGG + Intergenic
1019291839 7:254298-254320 CAGGGGTCTCTCCTGGCTGCAGG - Intronic
1020084539 7:5303365-5303387 GAGGGGTCCCTGGTGGAGGCTGG - Exonic
1026447667 7:70499595-70499617 CAGGGTTCTCTGGCTGAGGTGGG - Intronic
1026909396 7:74083696-74083718 CGGGGTTTTCTGGTGGGGGCGGG + Intronic
1031367201 7:120917355-120917377 CATGGCTCTCTGCTGGATGGAGG + Intergenic
1032441399 7:131945466-131945488 CCGGTTTCTCTGGAGGGTGCGGG + Intergenic
1032505026 7:132428142-132428164 CAGGGTTCTCTGGTGGGGGCAGG - Intronic
1033588152 7:142789457-142789479 CAGAGTTCTGTGCTGGAGGCTGG - Intergenic
1034971485 7:155422450-155422472 CAGGCTGCTCCAGTGGATGCTGG - Intergenic
1040561301 8:48525431-48525453 CAGGGAGCTCTTGTGGAGGCTGG + Intergenic
1040571935 8:48619220-48619242 CCGGGCTCTCTGATGGATGAAGG + Intergenic
1045655101 8:104378496-104378518 CATGGTACTCTGCTAGATGCTGG + Intronic
1045751154 8:105485402-105485424 CTGGGTTCTCTGGAGGCTGAGGG + Intronic
1048570018 8:135644551-135644573 CCGGGTTCTCTGGTAGACGAGGG + Intronic
1048982769 8:139711943-139711965 CTGGGTGCTGTGCTGGATGCCGG - Intergenic
1049844654 8:144793935-144793957 CAGGACTGTCAGGTGGATGCTGG - Intergenic
1051015109 9:12464640-12464662 CAGGGCTCTCTTGTGGATGATGG + Intergenic
1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG + Exonic
1054952935 9:70873299-70873321 CAGTGTTCTCTGGAGGCAGCTGG - Intronic
1055106019 9:72513917-72513939 CAGGTTTGTCTGGTGGATTTGGG + Intergenic
1056104354 9:83332402-83332424 CAGAGTTCTTTGGGGGATGGTGG - Intronic
1056795709 9:89657379-89657401 CAGTGTTTTCAGGTGGAAGCAGG - Intergenic
1057414858 9:94852168-94852190 AAGGCTTCTCTGGTGTAGGCAGG - Intronic
1059899315 9:118905021-118905043 AAGACTTCTCTTGTGGATGCTGG + Intergenic
1061481219 9:130898590-130898612 CAGGCTGGTCTGGTGGTTGCGGG + Intergenic
1061507018 9:131037133-131037155 CAGGACTCTCTGGTGGAGGCAGG - Intronic
1189409593 X:40758312-40758334 CAGGGGGCTCTGGAGGATCCAGG + Intergenic
1192300207 X:69893112-69893134 CATGCCTCTCTGGTGGCTGCTGG + Intronic
1192527501 X:71860423-71860445 CAGGAGGCTCTGGGGGATGCTGG - Intergenic
1192626239 X:72731604-72731626 CAGGGTTCTCTGCTGCATATTGG - Intergenic
1195001744 X:100649374-100649396 GAGGTTTCTTTGGTGGGTGCGGG - Intronic
1195993155 X:110703215-110703237 CAGGGGATTCTGATGGATGCAGG + Intronic
1196057802 X:111374766-111374788 CAGGGTTACCTGGTAGAAGCTGG - Intronic
1197068923 X:122269957-122269979 CAGGGCTCTCTGGTGATTACTGG + Intergenic
1198205166 X:134459024-134459046 CTGGGCACTGTGGTGGATGCTGG + Intergenic
1201781776 Y:17730988-17731010 CTGGGATTTCTGGTGTATGCCGG + Intergenic
1201819777 Y:18175002-18175024 CTGGGATTTCTGGTGTATGCCGG - Intergenic