ID: 1062930195

View in Genome Browser
Species Human (GRCh38)
Location 10:1347766-1347788
Sequence TGCACCGAAGGCACCCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062930190_1062930195 -1 Left 1062930190 10:1347744-1347766 CCTCTGGACCCCACGTACGCAGT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1062930195 10:1347766-1347788 TGCACCGAAGGCACCCCCAGTGG No data
1062930191_1062930195 -9 Left 1062930191 10:1347752-1347774 CCCCACGTACGCAGTGCACCGAA 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1062930195 10:1347766-1347788 TGCACCGAAGGCACCCCCAGTGG No data
1062930184_1062930195 29 Left 1062930184 10:1347714-1347736 CCTCCCGACAGCGCTCACAGGTA 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1062930195 10:1347766-1347788 TGCACCGAAGGCACCCCCAGTGG No data
1062930186_1062930195 25 Left 1062930186 10:1347718-1347740 CCGACAGCGCTCACAGGTAACGC 0: 1
1: 0
2: 1
3: 1
4: 29
Right 1062930195 10:1347766-1347788 TGCACCGAAGGCACCCCCAGTGG No data
1062930185_1062930195 26 Left 1062930185 10:1347717-1347739 CCCGACAGCGCTCACAGGTAACG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1062930195 10:1347766-1347788 TGCACCGAAGGCACCCCCAGTGG No data
1062930189_1062930195 2 Left 1062930189 10:1347741-1347763 CCTCCTCTGGACCCCACGTACGC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1062930195 10:1347766-1347788 TGCACCGAAGGCACCCCCAGTGG No data
1062930192_1062930195 -10 Left 1062930192 10:1347753-1347775 CCCACGTACGCAGTGCACCGAAG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1062930195 10:1347766-1347788 TGCACCGAAGGCACCCCCAGTGG No data
1062930188_1062930195 3 Left 1062930188 10:1347740-1347762 CCCTCCTCTGGACCCCACGTACG 0: 1
1: 0
2: 1
3: 3
4: 78
Right 1062930195 10:1347766-1347788 TGCACCGAAGGCACCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062930195 Original CRISPR TGCACCGAAGGCACCCCCAG TGG Intronic
No off target data available for this crispr