ID: 1062934392

View in Genome Browser
Species Human (GRCh38)
Location 10:1375087-1375109
Sequence GTGGTGCATGGGACTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062934377_1062934392 19 Left 1062934377 10:1375045-1375067 CCTTCAAAGACTCGTCACGCAGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1062934392 10:1375087-1375109 GTGGTGCATGGGACTCAGGAAGG No data
1062934385_1062934392 -5 Left 1062934385 10:1375069-1375091 CCCCATGGGGCTGGGCCTGTGGT No data
Right 1062934392 10:1375087-1375109 GTGGTGCATGGGACTCAGGAAGG No data
1062934386_1062934392 -6 Left 1062934386 10:1375070-1375092 CCCATGGGGCTGGGCCTGTGGTG 0: 1
1: 1
2: 0
3: 37
4: 407
Right 1062934392 10:1375087-1375109 GTGGTGCATGGGACTCAGGAAGG No data
1062934387_1062934392 -7 Left 1062934387 10:1375071-1375093 CCATGGGGCTGGGCCTGTGGTGC 0: 1
1: 1
2: 4
3: 76
4: 474
Right 1062934392 10:1375087-1375109 GTGGTGCATGGGACTCAGGAAGG No data
1062934376_1062934392 22 Left 1062934376 10:1375042-1375064 CCTCCTTCAAAGACTCGTCACGC 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1062934392 10:1375087-1375109 GTGGTGCATGGGACTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062934392 Original CRISPR GTGGTGCATGGGACTCAGGA AGG Intronic
No off target data available for this crispr